Incidental Mutation 'R8365:Epb41l2'
ID646147
Institutional Source Beutler Lab
Gene Symbol Epb41l2
Ensembl Gene ENSMUSG00000019978
Gene Nameerythrocyte membrane protein band 4.1 like 2
SynonymsNBL2, 4.1G, Epb4.1l2, D10Ertd398e
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.296) question?
Stock #R8365 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location25359798-25523519 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 25441686 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 34 (Q34K)
Ref Sequence ENSEMBL: ENSMUSP00000055122 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053748] [ENSMUST00000092645] [ENSMUST00000217929] [ENSMUST00000218903] [ENSMUST00000219166] [ENSMUST00000219224] [ENSMUST00000219805] [ENSMUST00000219900] [ENSMUST00000219967]
Predicted Effect probably benign
Transcript: ENSMUST00000053748
AA Change: Q34K

PolyPhen 2 Score 0.210 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000055122
Gene: ENSMUSG00000019978
AA Change: Q34K

DomainStartEndE-ValueType
B41 207 402 3.22e-76 SMART
FERM_C 406 496 2.15e-39 SMART
FA 499 545 1.93e-18 SMART
low complexity region 555 567 N/A INTRINSIC
Pfam:SAB 613 661 1.8e-23 PFAM
low complexity region 717 733 N/A INTRINSIC
low complexity region 751 763 N/A INTRINSIC
Pfam:4_1_CTD 875 981 1.1e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000092645
AA Change: Q34K

PolyPhen 2 Score 0.210 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000090314
Gene: ENSMUSG00000019978
AA Change: Q34K

DomainStartEndE-ValueType
B41 207 402 3.22e-76 SMART
FERM_C 406 496 2.15e-39 SMART
FA 499 545 1.93e-18 SMART
low complexity region 555 567 N/A INTRINSIC
Pfam:SAB 613 661 6.1e-27 PFAM
low complexity region 717 733 N/A INTRINSIC
low complexity region 751 763 N/A INTRINSIC
Pfam:4_1_CTD 869 982 8.2e-59 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000217929
AA Change: Q34K

PolyPhen 2 Score 0.660 (Sensitivity: 0.86; Specificity: 0.91)
Predicted Effect probably benign
Transcript: ENSMUST00000218903
AA Change: Q34K

PolyPhen 2 Score 0.043 (Sensitivity: 0.94; Specificity: 0.83)
Predicted Effect probably benign
Transcript: ENSMUST00000219166
AA Change: Q34K

PolyPhen 2 Score 0.210 (Sensitivity: 0.92; Specificity: 0.88)
Predicted Effect probably benign
Transcript: ENSMUST00000219224
AA Change: Q34K

PolyPhen 2 Score 0.210 (Sensitivity: 0.92; Specificity: 0.88)
Predicted Effect probably benign
Transcript: ENSMUST00000219805
AA Change: Q34K

PolyPhen 2 Score 0.210 (Sensitivity: 0.92; Specificity: 0.88)
Predicted Effect probably benign
Transcript: ENSMUST00000219900
AA Change: Q34K

PolyPhen 2 Score 0.210 (Sensitivity: 0.92; Specificity: 0.88)
Predicted Effect probably benign
Transcript: ENSMUST00000219967
AA Change: Q34K

PolyPhen 2 Score 0.210 (Sensitivity: 0.92; Specificity: 0.88)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal glutamatergic synapse formation, AMPAR responses and long-term potentiation. Male mice homozygous for a knock-out allele exhibit normal fertility. Male mice homozygous for a gene trap allele on a mixed background are infertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931417E11Rik A T 6: 73,469,346 N73K probably benign Het
A2ml1 A T 6: 128,580,955 C79* probably null Het
Abcc9 A T 6: 142,599,072 S1430T probably benign Het
Akap9 C G 5: 3,968,745 H1109D probably benign Het
Ankrd17 T C 5: 90,250,519 K1724R possibly damaging Het
Brf2 A G 8: 27,128,538 S13P possibly damaging Het
Cfap46 T A 7: 139,683,084 K18* probably null Het
Cym T G 3: 107,212,866 I306L probably benign Het
Cyp2c66 A T 19: 39,176,604 H343L probably benign Het
Cyp2d34 T C 15: 82,620,673 Y62C probably damaging Het
D630045J12Rik A G 6: 38,195,635 S533P probably benign Het
Dnajc10 A G 2: 80,346,558 Y619C probably damaging Het
Dnal1 T A 12: 84,131,389 probably null Het
Eif4g1 T A 16: 20,683,527 M914K probably damaging Het
Esyt1 T G 10: 128,516,553 N730H possibly damaging Het
Fbxo15 T G 18: 84,962,614 I238S probably damaging Het
Foxn3 T C 12: 99,341,468 K204E probably damaging Het
Gtf2i G A 5: 134,274,580 S279L probably benign Het
Hhatl A G 9: 121,789,865 M67T probably damaging Het
Itpkc C A 7: 27,212,352 R598L probably damaging Het
Kctd18 A T 1: 57,959,152 I263N probably damaging Het
Map1a T A 2: 121,308,047 M3002K probably damaging Het
Med13l T A 5: 118,728,644 S588T possibly damaging Het
Pcdh8 T A 14: 79,770,986 I46F probably damaging Het
Prdm6 T C 18: 53,552,065 V392A probably benign Het
Ptprt T A 2: 161,901,531 I497F probably benign Het
Rorc A G 3: 94,375,059 H22R probably benign Het
Scaf8 A G 17: 3,195,966 I777V possibly damaging Het
Shroom1 A T 11: 53,465,641 R444* probably null Het
Srcap C T 7: 127,549,697 T2030I probably damaging Het
Srgap3 A G 6: 112,816,734 S94P probably damaging Het
Srsf12 C G 4: 33,226,070 P111R probably damaging Het
Ssfa2 T C 2: 79,662,345 S1079P probably damaging Het
Ttc27 C T 17: 74,747,674 T325I probably damaging Het
Ucp1 A C 8: 83,293,999 H146P probably damaging Het
Vmn1r167 A T 7: 23,504,775 I272N probably benign Het
Vmn2r1 T C 3: 64,086,613 S127P possibly damaging Het
Vtcn1 A G 3: 100,883,829 D61G probably benign Het
Zfp994 A T 17: 22,201,246 C241S probably damaging Het
Other mutations in Epb41l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00234:Epb41l2 APN 10 25501836 missense probably damaging 1.00
IGL00826:Epb41l2 APN 10 25441722 missense probably benign 0.07
IGL01312:Epb41l2 APN 10 25441587 start codon destroyed probably null 1.00
IGL02123:Epb41l2 APN 10 25460844 missense probably damaging 1.00
IGL02448:Epb41l2 APN 10 25493595 missense possibly damaging 0.66
R0365:Epb41l2 UTSW 10 25469221 missense probably damaging 1.00
R0594:Epb41l2 UTSW 10 25443770 missense possibly damaging 0.53
R0826:Epb41l2 UTSW 10 25504192 missense probably damaging 1.00
R0837:Epb41l2 UTSW 10 25507816 missense probably damaging 1.00
R1243:Epb41l2 UTSW 10 25489043 missense possibly damaging 0.81
R1301:Epb41l2 UTSW 10 25443902 missense probably damaging 1.00
R1560:Epb41l2 UTSW 10 25495436 splice site probably null
R1752:Epb41l2 UTSW 10 25460792 missense probably damaging 1.00
R1813:Epb41l2 UTSW 10 25441568 splice site probably null
R1966:Epb41l2 UTSW 10 25441768 missense probably benign 0.01
R2276:Epb41l2 UTSW 10 25488944 unclassified probably benign
R4425:Epb41l2 UTSW 10 25506180 missense possibly damaging 0.81
R4445:Epb41l2 UTSW 10 25443803 missense possibly damaging 0.92
R4621:Epb41l2 UTSW 10 25502140 critical splice donor site probably null
R4720:Epb41l2 UTSW 10 25471626 missense probably damaging 1.00
R5026:Epb41l2 UTSW 10 25484308 missense possibly damaging 0.94
R5408:Epb41l2 UTSW 10 25468094 critical splice acceptor site probably null
R5703:Epb41l2 UTSW 10 25441767 missense probably damaging 1.00
R5896:Epb41l2 UTSW 10 25493596 missense probably damaging 0.96
R5974:Epb41l2 UTSW 10 25441815 missense possibly damaging 0.79
R6073:Epb41l2 UTSW 10 25501832 missense probably damaging 1.00
R6182:Epb41l2 UTSW 10 25507817 missense probably damaging 1.00
R6229:Epb41l2 UTSW 10 25499836 missense possibly damaging 0.73
R6276:Epb41l2 UTSW 10 25502124 missense probably damaging 0.98
R6321:Epb41l2 UTSW 10 25468128 missense probably damaging 0.98
R6737:Epb41l2 UTSW 10 25489018 splice site probably null
R6766:Epb41l2 UTSW 10 25473092 nonsense probably null
R6834:Epb41l2 UTSW 10 25493604 missense possibly damaging 0.92
R7023:Epb41l2 UTSW 10 25512977 missense probably damaging 1.00
R7258:Epb41l2 UTSW 10 25484287 missense probably damaging 1.00
R7688:Epb41l2 UTSW 10 25479138 missense probably damaging 0.97
R7769:Epb41l2 UTSW 10 25493573 missense probably benign
R7796:Epb41l2 UTSW 10 25443829 missense probably benign 0.15
Z1176:Epb41l2 UTSW 10 25441720 missense probably benign 0.03
Z1176:Epb41l2 UTSW 10 25499902 nonsense probably null
Z1177:Epb41l2 UTSW 10 25479741 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCACCACCAGACTGAAAGTGG -3'
(R):5'- TTCCACGTCAGCTTGAGTAGG -3'

Sequencing Primer
(F):5'- CACCAGACTGAAAGTGGGAAAGTC -3'
(R):5'- CTCCATCTTTGGCTACTACTAAATTG -3'
Posted On2020-09-02