Incidental Mutation 'R8373:Phgdh'
ID646533
Institutional Source Beutler Lab
Gene Symbol Phgdh
Ensembl Gene ENSMUSG00000053398
Gene Name3-phosphoglycerate dehydrogenase
SynonymsPGD, 3-PGDH, A10, PGAD, PGDH, SERA, 3PGDH
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8373 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location98313170-98339990 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 98321245 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 204 (T204I)
Ref Sequence ENSEMBL: ENSMUSP00000064755 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065793]
Predicted Effect probably damaging
Transcript: ENSMUST00000065793
AA Change: T204I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000064755
Gene: ENSMUSG00000053398
AA Change: T204I

DomainStartEndE-ValueType
Pfam:2-Hacid_dh 9 317 2.1e-42 PFAM
Pfam:2-Hacid_dh_C 111 285 3.5e-60 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000148488
SMART Domains Protein: ENSMUSP00000117525
Gene: ENSMUSG00000053398

DomainStartEndE-ValueType
Pfam:2-Hacid_dh 7 145 1.1e-27 PFAM
Pfam:2-Hacid_dh_C 83 149 1.3e-21 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the enzyme which is involved in the early steps of L-serine synthesis in animal cells. L-serine is required for D-serine and other amino acid synthesis. The enzyme requires NAD/NADH as a cofactor and forms homotetramers for activity. Mutations in this gene have been found in a family with congenital microcephaly, psychomotor retardation and other symptoms. Multiple alternatively spliced transcript variants have been found, however the full-length nature of most are not known. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a null allele die by E13.5 and exhibit abnormal neural development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210010C04Rik T G 6: 41,031,688 T231P possibly damaging Het
Adgrg6 T C 10: 14,467,334 T290A probably benign Het
Aff4 C T 11: 53,400,267 Q685* probably null Het
Ankmy1 A G 1: 92,896,094 M150T probably damaging Het
Armc1 T C 3: 19,149,567 Y65C probably damaging Het
Armc8 A G 9: 99,527,099 V222A probably benign Het
Bcar1 A T 8: 111,715,738 Y228* probably null Het
Cct2 T C 10: 117,060,824 D158G possibly damaging Het
Cul1 T A 6: 47,515,063 C426S possibly damaging Het
Deup1 G T 9: 15,592,375 L297M possibly damaging Het
Dpp10 A G 1: 123,854,229 S74P possibly damaging Het
Epha4 A G 1: 77,507,079 Y98H possibly damaging Het
Epn3 T G 11: 94,492,936 D296A probably damaging Het
Eri2 A C 7: 119,772,597 I252S probably benign Het
Gm14025 T A 2: 129,038,171 I612F Het
Gp9 C T 6: 87,779,012 T3I probably benign Het
H2-Q5 T A 17: 35,394,456 V55E Het
Kif3c G T 12: 3,366,089 V37L probably benign Het
Lct A T 1: 128,303,840 N757K probably damaging Het
Lhx8 A C 3: 154,324,658 N112K probably damaging Het
Loxl3 T A 6: 83,048,891 S373R possibly damaging Het
Mettl4 G A 17: 94,733,649 T359I probably damaging Het
Mpp7 A G 18: 7,444,096 S109P probably damaging Het
Nckap5 A G 1: 126,026,295 V840A probably benign Het
Ncoa4 T A 14: 32,176,936 L571Q probably damaging Het
Olfr453 T C 6: 42,744,346 F103S probably damaging Het
Olfr46 A T 7: 140,610,295 Y35F possibly damaging Het
Pla2g4d C T 2: 120,277,499 V310M probably null Het
Psmd12 C T 11: 107,497,624 P421L probably damaging Het
Ptch1 A G 13: 63,541,168 Y432H probably damaging Het
Rapgef1 G A 2: 29,710,231 G655S probably damaging Het
Rilpl2 C A 5: 124,478,034 A18S probably damaging Het
Srsf7 T C 17: 80,205,386 R88G probably benign Het
St6galnac1 T C 11: 116,769,233 K85E possibly damaging Het
Trip12 A T 1: 84,795,767 S49R probably damaging Het
Wdr48 A G 9: 119,905,494 T160A probably damaging Het
Zfp704 G A 3: 9,609,442 T93M unknown Het
Other mutations in Phgdh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Phgdh APN 3 98328315 missense probably damaging 1.00
R0195:Phgdh UTSW 3 98316550 unclassified probably benign
R0636:Phgdh UTSW 3 98333291 missense possibly damaging 0.89
R0787:Phgdh UTSW 3 98334549 missense probably damaging 1.00
R1626:Phgdh UTSW 3 98316409 missense probably benign 0.16
R1733:Phgdh UTSW 3 98328135 missense probably benign 0.00
R1782:Phgdh UTSW 3 98320747 missense probably damaging 0.97
R2173:Phgdh UTSW 3 98315111 missense probably benign 0.00
R2256:Phgdh UTSW 3 98328291 missense probably benign 0.30
R2367:Phgdh UTSW 3 98314296 missense probably benign 0.07
R2495:Phgdh UTSW 3 98339789 missense probably damaging 1.00
R4214:Phgdh UTSW 3 98328061 missense possibly damaging 0.79
R4410:Phgdh UTSW 3 98314275 missense probably benign
R5062:Phgdh UTSW 3 98328339 missense probably damaging 1.00
R5378:Phgdh UTSW 3 98321323 splice site probably null
R5528:Phgdh UTSW 3 98328339 missense probably benign 0.13
R7357:Phgdh UTSW 3 98339822 missense probably benign 0.00
R7436:Phgdh UTSW 3 98339729 missense probably benign 0.34
R7894:Phgdh UTSW 3 98339808 missense probably damaging 0.98
R8467:Phgdh UTSW 3 98321311 missense probably benign
R8762:Phgdh UTSW 3 98339708 missense possibly damaging 0.51
Predicted Primers PCR Primer
(F):5'- CGGGATGCCAGTTGTACTAC -3'
(R):5'- CGTGTGGCACCAGTTACTGATG -3'

Sequencing Primer
(F):5'- GGATGCCAGTTGTACTACCTCAG -3'
(R):5'- CACCAGTTACTGATGGTGCAGTTAC -3'
Posted On2020-09-02