Incidental Mutation 'R7961:Krtap5-4'
ID650117
Institutional Source Beutler Lab
Gene Symbol Krtap5-4
Ensembl Gene ENSMUSG00000045236
Gene Namekeratin associated protein 5-4
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.125) question?
Stock #R7961 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location142303549-142304594 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 142303934 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 114 (Q114*)
Ref Sequence ENSEMBL: ENSMUSP00000059461 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061403]
Predicted Effect probably null
Transcript: ENSMUST00000061403
AA Change: Q114*
SMART Domains Protein: ENSMUSP00000059461
Gene: ENSMUSG00000045236
AA Change: Q114*

DomainStartEndE-ValueType
Pfam:Keratin_B2_2 119 163 1.4e-5 PFAM
Pfam:Keratin_B2_2 183 222 1.1e-6 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 94% (44/47)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b T A 5: 8,828,870 N751K possibly damaging Het
Bckdha G A 7: 25,631,478 R288W probably damaging Het
C87414 T C 5: 93,636,684 D307G probably damaging Het
Ccng1 G A 11: 40,751,269 H229Y probably benign Het
Cenpn C A 8: 116,937,237 T256N probably benign Het
Ciart A G 3: 95,881,317 V70A possibly damaging Het
Clcc1 A G 3: 108,661,458 N36S probably damaging Het
Cntnap1 G A 11: 101,178,295 A192T probably benign Het
Dmrt1 T A 19: 25,545,881 S199T possibly damaging Het
Dmrt3 T C 19: 25,610,908 V37A possibly damaging Het
Dock1 T A 7: 134,745,057 D239E possibly damaging Het
Dyrk3 A G 1: 131,136,258 probably null Het
Engase A G 11: 118,486,860 D571G possibly damaging Het
Gm45871 C T 18: 90,591,759 H374Y probably damaging Het
Icam5 T C 9: 21,038,755 V870A possibly damaging Het
Idh2 T C 7: 80,098,253 H233R probably benign Het
Kcna5 A G 6: 126,533,554 L537P probably benign Het
Krt71 T C 15: 101,735,442 I454V probably damaging Het
Loxl3 T C 6: 83,050,809 F734S possibly damaging Het
Lpcat1 C T 13: 73,511,379 T420I probably damaging Het
Mia2 T A 12: 59,159,639 probably null Het
Neurod4 A T 10: 130,270,487 V306D possibly damaging Het
Nkiras2 A T 11: 100,619,802 probably benign Het
Nrp2 C T 1: 62,745,408 R239C probably damaging Het
Ntrk3 T A 7: 78,453,328 D408V probably benign Het
Nubpl T A 12: 52,181,297 L168* probably null Het
Odf1 A G 15: 38,226,596 I247V unknown Het
Olfr1170 C A 2: 88,224,689 M114I possibly damaging Het
Olfr1260 A G 2: 89,977,787 Q3R probably benign Het
Olfr1298 G A 2: 111,645,937 S20F probably damaging Het
Pcsk1 T C 13: 75,126,839 S516P probably benign Het
Pikfyve A G 1: 65,255,134 D1411G probably damaging Het
Polm T C 11: 5,830,155 D294G possibly damaging Het
Ppcs A T 4: 119,419,065 S281T probably benign Het
Pspc1 G A 14: 56,771,847 Q177* probably null Het
Rbm33 G A 5: 28,394,608 G185R Het
Satb2 A G 1: 56,871,758 S243P probably benign Het
Serinc5 T C 13: 92,661,191 probably null Het
Sgsm1 T C 5: 113,282,644 T292A probably damaging Het
Smad3 G A 9: 63,650,282 R420C possibly damaging Het
Sntg1 C T 1: 8,363,570 V486I probably damaging Het
Tep1 A G 14: 50,824,230 S2610P possibly damaging Het
Tmem200a A G 10: 25,994,006 S122P probably damaging Het
Tnks2 T A 19: 36,852,501 M194K probably benign Het
Trav14d-3-dv8 A C 14: 53,078,767 Q28P probably damaging Het
Trpm5 T C 7: 143,080,369 E700G probably benign Het
Ubqln3 T A 7: 104,142,590 I98L probably benign Het
Usp25 A G 16: 77,059,262 I248V probably damaging Het
Vmn1r28 T C 6: 58,265,193 V7A probably benign Het
Zfp60 G A 7: 27,748,456 G183D probably benign Het
Other mutations in Krtap5-4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01019:Krtap5-4 APN 7 142303910 missense unknown
R2307:Krtap5-4 UTSW 7 142303614 nonsense probably null
R4657:Krtap5-4 UTSW 7 142303754 missense unknown
R6318:Krtap5-4 UTSW 7 142304090 missense unknown
R7084:Krtap5-4 UTSW 7 142303872 missense unknown
R7162:Krtap5-4 UTSW 7 142303598 missense unknown
R7876:Krtap5-4 UTSW 7 142303848 missense unknown
R8009:Krtap5-4 UTSW 7 142303934 nonsense probably null
X0052:Krtap5-4 UTSW 7 142303904 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CCTGGGCAGGGATATAAAGACC -3'
(R):5'- AGGGTTTACAGCAGCTGGAC -3'

Sequencing Primer
(F):5'- AGAACCATGACCTGCTGTG -3'
(R):5'- CAGCTGGACTGGCAGCAAG -3'
Posted On2020-09-15