Incidental Mutation 'R7961:Pspc1'
ID650135
Institutional Source Beutler Lab
Gene Symbol Pspc1
Ensembl Gene ENSMUSG00000021938
Gene Nameparaspeckle protein 1
Synonyms5730470C09Rik, PSP1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7961 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location56720710-56778316 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 56771847 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 177 (Q177*)
Ref Sequence ENSEMBL: ENSMUSP00000022507 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022507] [ENSMUST00000163924]
Predicted Effect probably null
Transcript: ENSMUST00000022507
AA Change: Q177*
SMART Domains Protein: ENSMUSP00000022507
Gene: ENSMUSG00000021938
AA Change: Q177*

DomainStartEndE-ValueType
low complexity region 23 42 N/A INTRINSIC
RRM 82 149 8.91e-21 SMART
RRM 156 232 1.51e-9 SMART
low complexity region 298 310 N/A INTRINSIC
low complexity region 320 344 N/A INTRINSIC
low complexity region 350 376 N/A INTRINSIC
low complexity region 417 430 N/A INTRINSIC
low complexity region 433 452 N/A INTRINSIC
low complexity region 494 516 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000163924
AA Change: Q177*
SMART Domains Protein: ENSMUSP00000133038
Gene: ENSMUSG00000021938
AA Change: Q177*

DomainStartEndE-ValueType
low complexity region 23 42 N/A INTRINSIC
RRM 82 149 8.91e-21 SMART
RRM 156 232 1.51e-9 SMART
low complexity region 298 310 N/A INTRINSIC
low complexity region 320 344 N/A INTRINSIC
low complexity region 350 376 N/A INTRINSIC
low complexity region 417 430 N/A INTRINSIC
low complexity region 433 452 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168575
SMART Domains Protein: ENSMUSP00000125780
Gene: ENSMUSG00000021938

DomainStartEndE-ValueType
RRM 5 56 2.12e-4 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 94% (44/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nucleolar protein that localizes to punctate subnuclear structures that occur close to splicing speckles, known as paraspeckles. These paraspeckles are composed of RNA-protein structures that include a non-coding RNA, NEAT1/Men epsilon/beta, and the Drosophila Behavior Human Splicing family of proteins, which include the product of this gene and the P54NRB/NONO and PSF/SFPQ proteins. Paraspeckles may function in the control of gene expression via an RNA nuclear retention mechanism. The protein encoded by this gene is found in paraspeckles in transcriptionally active cells, but it localizes to unique cap structures at the nucleolar periphery when RNA polymerase II transcription is inhibited, or during telophase. Alternative splicing of this gene results in multiple transcript variants. A related pseudogene, which is also located on chromosome 13, has been identified. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a gene trap allele do not display any gross abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b T A 5: 8,828,870 N751K possibly damaging Het
Bckdha G A 7: 25,631,478 R288W probably damaging Het
C87414 T C 5: 93,636,684 D307G probably damaging Het
Ccng1 G A 11: 40,751,269 H229Y probably benign Het
Cenpn C A 8: 116,937,237 T256N probably benign Het
Ciart A G 3: 95,881,317 V70A possibly damaging Het
Clcc1 A G 3: 108,661,458 N36S probably damaging Het
Cntnap1 G A 11: 101,178,295 A192T probably benign Het
Dmrt1 T A 19: 25,545,881 S199T possibly damaging Het
Dmrt3 T C 19: 25,610,908 V37A possibly damaging Het
Dock1 T A 7: 134,745,057 D239E possibly damaging Het
Dyrk3 A G 1: 131,136,258 probably null Het
Engase A G 11: 118,486,860 D571G possibly damaging Het
Gm45871 C T 18: 90,591,759 H374Y probably damaging Het
Icam5 T C 9: 21,038,755 V870A possibly damaging Het
Idh2 T C 7: 80,098,253 H233R probably benign Het
Kcna5 A G 6: 126,533,554 L537P probably benign Het
Krt71 T C 15: 101,735,442 I454V probably damaging Het
Krtap5-4 C T 7: 142,303,934 Q114* probably null Het
Loxl3 T C 6: 83,050,809 F734S possibly damaging Het
Lpcat1 C T 13: 73,511,379 T420I probably damaging Het
Mia2 T A 12: 59,159,639 probably null Het
Neurod4 A T 10: 130,270,487 V306D possibly damaging Het
Nkiras2 A T 11: 100,619,802 probably benign Het
Nrp2 C T 1: 62,745,408 R239C probably damaging Het
Ntrk3 T A 7: 78,453,328 D408V probably benign Het
Nubpl T A 12: 52,181,297 L168* probably null Het
Odf1 A G 15: 38,226,596 I247V unknown Het
Olfr1170 C A 2: 88,224,689 M114I possibly damaging Het
Olfr1260 A G 2: 89,977,787 Q3R probably benign Het
Olfr1298 G A 2: 111,645,937 S20F probably damaging Het
Pcsk1 T C 13: 75,126,839 S516P probably benign Het
Pikfyve A G 1: 65,255,134 D1411G probably damaging Het
Polm T C 11: 5,830,155 D294G possibly damaging Het
Ppcs A T 4: 119,419,065 S281T probably benign Het
Rbm33 G A 5: 28,394,608 G185R Het
Satb2 A G 1: 56,871,758 S243P probably benign Het
Serinc5 T C 13: 92,661,191 probably null Het
Sgsm1 T C 5: 113,282,644 T292A probably damaging Het
Smad3 G A 9: 63,650,282 R420C possibly damaging Het
Sntg1 C T 1: 8,363,570 V486I probably damaging Het
Tep1 A G 14: 50,824,230 S2610P possibly damaging Het
Tmem200a A G 10: 25,994,006 S122P probably damaging Het
Tnks2 T A 19: 36,852,501 M194K probably benign Het
Trav14d-3-dv8 A C 14: 53,078,767 Q28P probably damaging Het
Trpm5 T C 7: 143,080,369 E700G probably benign Het
Ubqln3 T A 7: 104,142,590 I98L probably benign Het
Usp25 A G 16: 77,059,262 I248V probably damaging Het
Vmn1r28 T C 6: 58,265,193 V7A probably benign Het
Zfp60 G A 7: 27,748,456 G183D probably benign Het
Other mutations in Pspc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Pspc1 APN 14 56771711 missense probably damaging 1.00
IGL02281:Pspc1 APN 14 56723178 missense probably benign
IGL02954:Pspc1 APN 14 56771760 missense probably benign 0.17
IGL02989:Pspc1 APN 14 56771696 intron probably benign
perspicacious UTSW 14 56771847 nonsense probably null
R1549:Pspc1 UTSW 14 56748941 missense probably damaging 1.00
R1696:Pspc1 UTSW 14 56764243 missense probably benign 0.02
R4574:Pspc1 UTSW 14 56761947 missense possibly damaging 0.91
R4599:Pspc1 UTSW 14 56777789 critical splice donor site probably null
R5132:Pspc1 UTSW 14 56723250 missense probably benign 0.09
R5243:Pspc1 UTSW 14 56764191 missense probably damaging 1.00
R5519:Pspc1 UTSW 14 56771956 missense probably benign 0.11
R5610:Pspc1 UTSW 14 56777931 missense probably damaging 1.00
R5724:Pspc1 UTSW 14 56778072 missense probably benign 0.01
R5867:Pspc1 UTSW 14 56762041 splice site probably null
R5968:Pspc1 UTSW 14 56764236 missense probably benign 0.14
R6544:Pspc1 UTSW 14 56764203 makesense probably null
R7034:Pspc1 UTSW 14 56758628 critical splice donor site probably null
R7036:Pspc1 UTSW 14 56758628 critical splice donor site probably null
R8009:Pspc1 UTSW 14 56771847 nonsense probably null
R8184:Pspc1 UTSW 14 56764243 missense probably benign 0.02
R8221:Pspc1 UTSW 14 56778159 start codon destroyed probably benign 0.01
X0065:Pspc1 UTSW 14 56725415 missense possibly damaging 0.79
Z1177:Pspc1 UTSW 14 56748875 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TCCATATTTAACTGGACAGAGGACAAG -3'
(R):5'- AGTCTTCTTAGAGCCAAACCAC -3'

Sequencing Primer
(F):5'- GGACAAGAGAGTTAAAACTTACGTTG -3'
(R):5'- ACTGAAGAGCAGACCTCT -3'
Posted On2020-09-15