Incidental Mutation 'R2859:Mink1'
ID 252665
Institutional Source Beutler Lab
Gene Symbol Mink1
Ensembl Gene ENSMUSG00000020827
Gene Name misshapen-like kinase 1 (zebrafish)
Synonyms Misshapen/NIKs-related kinase, Map4k6, Ysk2, MINK
MMRRC Submission 040449-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R2859 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 70453707-70505309 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 70503334 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 1143 (V1143A)
Ref Sequence ENSEMBL: ENSMUSP00000072091 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014753] [ENSMUST00000072237] [ENSMUST00000072873] [ENSMUST00000079244] [ENSMUST00000102556] [ENSMUST00000102558] [ENSMUST00000102559] [ENSMUST00000180052] [ENSMUST00000144960] [ENSMUST00000135865]
AlphaFold Q9JM52
Predicted Effect probably benign
Transcript: ENSMUST00000014753
SMART Domains Protein: ENSMUSP00000014753
Gene: ENSMUSG00000014609

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Neur_chan_LBD 24 240 2.9e-65 PFAM
Pfam:Neur_chan_memb 247 475 6.5e-58 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000072237
AA Change: V1143A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000072091
Gene: ENSMUSG00000020827
AA Change: V1143A

DomainStartEndE-ValueType
S_TKc 25 289 1.86e-91 SMART
low complexity region 307 338 N/A INTRINSIC
coiled coil region 351 496 N/A INTRINSIC
low complexity region 557 569 N/A INTRINSIC
low complexity region 620 633 N/A INTRINSIC
low complexity region 646 659 N/A INTRINSIC
low complexity region 719 738 N/A INTRINSIC
low complexity region 837 874 N/A INTRINSIC
CNH 1026 1324 1.58e-113 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000072873
AA Change: V1136A

PolyPhen 2 Score 0.511 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000072649
Gene: ENSMUSG00000020827
AA Change: V1136A

DomainStartEndE-ValueType
S_TKc 25 289 1.86e-91 SMART
low complexity region 307 338 N/A INTRINSIC
coiled coil region 351 496 N/A INTRINSIC
low complexity region 557 569 N/A INTRINSIC
low complexity region 620 633 N/A INTRINSIC
low complexity region 646 659 N/A INTRINSIC
low complexity region 719 738 N/A INTRINSIC
low complexity region 829 853 N/A INTRINSIC
CNH 1019 1317 1.58e-113 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000079244
AA Change: V1133A

PolyPhen 2 Score 0.511 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000078234
Gene: ENSMUSG00000020827
AA Change: V1133A

DomainStartEndE-ValueType
S_TKc 25 289 1.86e-91 SMART
low complexity region 314 338 N/A INTRINSIC
coiled coil region 348 493 N/A INTRINSIC
low complexity region 554 566 N/A INTRINSIC
low complexity region 617 630 N/A INTRINSIC
low complexity region 643 656 N/A INTRINSIC
low complexity region 716 735 N/A INTRINSIC
low complexity region 826 850 N/A INTRINSIC
CNH 1016 1314 1.58e-113 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102556
SMART Domains Protein: ENSMUSP00000099616
Gene: ENSMUSG00000014609

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Neur_chan_LBD 24 240 5.4e-65 PFAM
Pfam:Neur_chan_memb 247 474 2.9e-53 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000102558
AA Change: V1099A

PolyPhen 2 Score 0.455 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000099618
Gene: ENSMUSG00000020827
AA Change: V1099A

DomainStartEndE-ValueType
S_TKc 25 289 1.86e-91 SMART
low complexity region 307 338 N/A INTRINSIC
coiled coil region 351 496 N/A INTRINSIC
low complexity region 557 569 N/A INTRINSIC
low complexity region 620 633 N/A INTRINSIC
low complexity region 646 659 N/A INTRINSIC
low complexity region 792 816 N/A INTRINSIC
CNH 982 1280 1.58e-113 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000102559
AA Change: V1107A

PolyPhen 2 Score 0.511 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000099619
Gene: ENSMUSG00000020827
AA Change: V1107A

DomainStartEndE-ValueType
S_TKc 25 289 1.86e-91 SMART
low complexity region 307 338 N/A INTRINSIC
coiled coil region 351 496 N/A INTRINSIC
low complexity region 557 569 N/A INTRINSIC
low complexity region 620 633 N/A INTRINSIC
low complexity region 646 659 N/A INTRINSIC
low complexity region 800 824 N/A INTRINSIC
CNH 990 1288 1.58e-113 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125387
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125853
Predicted Effect unknown
Transcript: ENSMUST00000136663
AA Change: V996A
SMART Domains Protein: ENSMUSP00000117959
Gene: ENSMUSG00000020827
AA Change: V996A

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 1 140 2.3e-22 PFAM
Pfam:Pkinase 1 143 1.6e-30 PFAM
low complexity region 161 192 N/A INTRINSIC
coiled coil region 204 349 N/A INTRINSIC
low complexity region 411 423 N/A INTRINSIC
low complexity region 474 487 N/A INTRINSIC
low complexity region 500 513 N/A INTRINSIC
low complexity region 573 592 N/A INTRINSIC
low complexity region 691 728 N/A INTRINSIC
CNH 880 1178 1.58e-113 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135920
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134836
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152857
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153503
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142650
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132208
Predicted Effect probably benign
Transcript: ENSMUST00000180052
SMART Domains Protein: ENSMUSP00000137259
Gene: ENSMUSG00000087279

DomainStartEndE-ValueType
low complexity region 29 40 N/A INTRINSIC
low complexity region 119 130 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000144960
SMART Domains Protein: ENSMUSP00000136077
Gene: ENSMUSG00000087279

DomainStartEndE-ValueType
low complexity region 29 40 N/A INTRINSIC
low complexity region 119 130 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000135865
SMART Domains Protein: ENSMUSP00000135933
Gene: ENSMUSG00000087279

DomainStartEndE-ValueType
low complexity region 29 40 N/A INTRINSIC
low complexity region 101 107 N/A INTRINSIC
Meta Mutation Damage Score 0.6917 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a serine/threonine kinase belonging to the germinal center kinase (GCK) family. The protein is structurally similar to the kinases that are related to NIK and may belong to a distinct subfamily of NIK-related kinases within the GCK family. Studies of the mouse homolog indicate an up-regulation of expression in the course of postnatal mouse cerebral development and activation of the cJun N-terminal kinase (JNK) and the p38 pathways. [provided by RefSeq, Mar 2016]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 T C 17: 24,500,288 (GRCm39) Y1301C possibly damaging Het
Amfr A T 8: 94,731,842 (GRCm39) N11K probably damaging Het
Cadm3 A G 1: 173,174,112 (GRCm39) S34P possibly damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,619,782 (GRCm39) probably benign Het
Cdh23 C T 10: 60,218,432 (GRCm39) probably null Het
Ceacam1 T A 7: 25,173,442 (GRCm39) I249F probably damaging Het
Cuzd1 C T 7: 130,917,863 (GRCm39) V246M probably damaging Het
Ehd2 A T 7: 15,698,054 (GRCm39) V61E probably damaging Het
Fibin C T 2: 110,192,542 (GRCm39) R200H probably damaging Het
Fmo9 A C 1: 166,501,236 (GRCm39) F237C probably damaging Het
Garin3 T C 11: 46,296,039 (GRCm39) I137T probably damaging Het
Hivep2 C A 10: 14,004,713 (GRCm39) T437K probably benign Het
Iqgap3 C A 3: 88,014,903 (GRCm39) S873* probably null Het
Ism2 T C 12: 87,346,437 (GRCm39) M15V unknown Het
Itk T G 11: 46,235,662 (GRCm39) probably benign Het
Mastl C A 2: 23,029,979 (GRCm39) C249F probably damaging Het
Mrgprb4 T A 7: 47,848,084 (GRCm39) R281S possibly damaging Het
Mthfd1 T C 12: 76,335,699 (GRCm39) Y258H probably damaging Het
Ntmt1 A G 2: 30,712,377 (GRCm39) H140R probably damaging Het
Or1j12 T C 2: 36,343,142 (GRCm39) S182P probably benign Het
Or3a10 C T 11: 73,935,653 (GRCm39) G149D possibly damaging Het
Or3a1b T C 11: 74,012,808 (GRCm39) I231T probably damaging Het
Or9e1 T A 11: 58,732,708 (GRCm39) V256E probably benign Het
Parm1 A G 5: 91,742,165 (GRCm39) T178A possibly damaging Het
Patl1 T C 19: 11,901,195 (GRCm39) F282L probably damaging Het
Phospho2 T C 2: 69,626,195 (GRCm39) V117A possibly damaging Het
Ppp4r3a T C 12: 101,008,906 (GRCm39) probably null Het
Pramel29 A G 4: 143,936,192 (GRCm39) S23P probably benign Het
Rbm17 A G 2: 11,595,515 (GRCm39) F230S possibly damaging Het
Robo3 C A 9: 37,339,400 (GRCm39) G196* probably null Het
Samhd1 A G 2: 156,948,149 (GRCm39) probably null Het
Setx GTGGCT GT 2: 29,044,073 (GRCm39) 1814 probably null Het
Thbs4 A G 13: 92,927,216 (GRCm39) F91S probably benign Het
Trim34b A T 7: 103,985,439 (GRCm39) N358I probably benign Het
Ulk1 A G 5: 110,942,495 (GRCm39) L255P probably damaging Het
Vmn2r104 T A 17: 20,268,455 (GRCm39) I5F possibly damaging Het
Vrk2 C A 11: 26,433,324 (GRCm39) S286I possibly damaging Het
Zswim3 T C 2: 164,662,309 (GRCm39) L263P probably damaging Het
Other mutations in Mink1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00501:Mink1 APN 11 70,494,638 (GRCm39) missense probably damaging 0.99
IGL00709:Mink1 APN 11 70,503,845 (GRCm39) missense probably damaging 0.99
IGL01064:Mink1 APN 11 70,494,307 (GRCm39) missense probably benign 0.05
IGL02612:Mink1 APN 11 70,488,052 (GRCm39) missense probably damaging 1.00
IGL02797:Mink1 APN 11 70,501,176 (GRCm39) missense probably damaging 1.00
IGL03056:Mink1 APN 11 70,503,409 (GRCm39) critical splice donor site probably null
IGL03066:Mink1 APN 11 70,499,715 (GRCm39) missense probably benign 0.01
IGL03185:Mink1 APN 11 70,494,686 (GRCm39) missense probably damaging 1.00
PIT4498001:Mink1 UTSW 11 70,489,714 (GRCm39) missense probably benign 0.05
R0025:Mink1 UTSW 11 70,503,868 (GRCm39) missense probably damaging 1.00
R0025:Mink1 UTSW 11 70,503,868 (GRCm39) missense probably damaging 1.00
R0488:Mink1 UTSW 11 70,488,030 (GRCm39) missense probably damaging 1.00
R0637:Mink1 UTSW 11 70,492,502 (GRCm39) missense probably damaging 0.96
R0828:Mink1 UTSW 11 70,500,971 (GRCm39) nonsense probably null
R1081:Mink1 UTSW 11 70,497,861 (GRCm39) missense probably benign 0.07
R1175:Mink1 UTSW 11 70,502,166 (GRCm39) missense probably benign 0.02
R1441:Mink1 UTSW 11 70,497,940 (GRCm39) missense possibly damaging 0.72
R1532:Mink1 UTSW 11 70,492,833 (GRCm39) missense probably null 1.00
R1545:Mink1 UTSW 11 70,489,717 (GRCm39) missense possibly damaging 0.60
R1634:Mink1 UTSW 11 70,499,706 (GRCm39) missense probably benign 0.00
R1932:Mink1 UTSW 11 70,499,254 (GRCm39) critical splice donor site probably null
R2033:Mink1 UTSW 11 70,503,334 (GRCm39) missense probably damaging 1.00
R2184:Mink1 UTSW 11 70,494,623 (GRCm39) missense probably damaging 1.00
R2267:Mink1 UTSW 11 70,492,550 (GRCm39) splice site probably null
R2268:Mink1 UTSW 11 70,492,550 (GRCm39) splice site probably null
R3713:Mink1 UTSW 11 70,499,776 (GRCm39) missense possibly damaging 0.93
R3714:Mink1 UTSW 11 70,499,776 (GRCm39) missense possibly damaging 0.93
R3715:Mink1 UTSW 11 70,499,776 (GRCm39) missense possibly damaging 0.93
R3716:Mink1 UTSW 11 70,498,587 (GRCm39) missense probably damaging 0.98
R3717:Mink1 UTSW 11 70,498,587 (GRCm39) missense probably damaging 0.98
R4607:Mink1 UTSW 11 70,496,893 (GRCm39) missense possibly damaging 0.72
R4735:Mink1 UTSW 11 70,500,086 (GRCm39) splice site probably null
R4790:Mink1 UTSW 11 70,489,867 (GRCm39) missense probably damaging 0.99
R4847:Mink1 UTSW 11 70,492,854 (GRCm39) missense probably damaging 1.00
R4860:Mink1 UTSW 11 70,502,418 (GRCm39) missense probably damaging 0.98
R4860:Mink1 UTSW 11 70,502,418 (GRCm39) missense probably damaging 0.98
R5081:Mink1 UTSW 11 70,495,970 (GRCm39) missense probably damaging 0.98
R5310:Mink1 UTSW 11 70,498,169 (GRCm39) missense probably benign 0.33
R5677:Mink1 UTSW 11 70,495,991 (GRCm39) missense possibly damaging 0.66
R5767:Mink1 UTSW 11 70,496,901 (GRCm39) missense possibly damaging 0.53
R5795:Mink1 UTSW 11 70,498,616 (GRCm39) missense possibly damaging 0.86
R5888:Mink1 UTSW 11 70,500,885 (GRCm39) unclassified probably benign
R5950:Mink1 UTSW 11 70,500,412 (GRCm39) missense possibly damaging 0.81
R6024:Mink1 UTSW 11 70,489,915 (GRCm39) missense possibly damaging 0.71
R6034:Mink1 UTSW 11 70,497,866 (GRCm39) small deletion probably benign
R6034:Mink1 UTSW 11 70,497,866 (GRCm39) small deletion probably benign
R6058:Mink1 UTSW 11 70,502,546 (GRCm39) missense possibly damaging 0.96
R6144:Mink1 UTSW 11 70,501,478 (GRCm39) missense possibly damaging 0.66
R6154:Mink1 UTSW 11 70,500,927 (GRCm39) missense possibly damaging 0.46
R6218:Mink1 UTSW 11 70,489,720 (GRCm39) missense possibly damaging 0.94
R6262:Mink1 UTSW 11 70,494,151 (GRCm39) splice site probably null
R6269:Mink1 UTSW 11 70,489,813 (GRCm39) missense probably damaging 1.00
R6273:Mink1 UTSW 11 70,502,261 (GRCm39) nonsense probably null
R6301:Mink1 UTSW 11 70,503,120 (GRCm39) missense possibly damaging 0.71
R6603:Mink1 UTSW 11 70,500,419 (GRCm39) missense probably damaging 0.96
R6876:Mink1 UTSW 11 70,498,261 (GRCm39) missense probably benign 0.02
R7030:Mink1 UTSW 11 70,498,601 (GRCm39) missense possibly damaging 0.46
R7050:Mink1 UTSW 11 70,503,158 (GRCm39) missense possibly damaging 0.93
R7094:Mink1 UTSW 11 70,500,901 (GRCm39) splice site probably null
R7135:Mink1 UTSW 11 70,494,329 (GRCm39) missense probably damaging 1.00
R7238:Mink1 UTSW 11 70,502,305 (GRCm39) critical splice donor site probably null
R7320:Mink1 UTSW 11 70,489,899 (GRCm39) missense probably benign 0.23
R7396:Mink1 UTSW 11 70,495,994 (GRCm39) missense possibly damaging 0.73
R7446:Mink1 UTSW 11 70,500,455 (GRCm39) missense probably benign 0.18
R7723:Mink1 UTSW 11 70,503,736 (GRCm39) missense probably benign 0.16
R7896:Mink1 UTSW 11 70,503,108 (GRCm39) missense possibly damaging 0.71
R8058:Mink1 UTSW 11 70,494,594 (GRCm39) nonsense probably null
R8082:Mink1 UTSW 11 70,504,103 (GRCm39) missense possibly damaging 0.71
R8160:Mink1 UTSW 11 70,496,907 (GRCm39) nonsense probably null
R8335:Mink1 UTSW 11 70,500,401 (GRCm39) missense probably damaging 0.97
R8353:Mink1 UTSW 11 70,501,154 (GRCm39) missense possibly damaging 0.70
R8453:Mink1 UTSW 11 70,501,154 (GRCm39) missense possibly damaging 0.70
R8732:Mink1 UTSW 11 70,500,902 (GRCm39) critical splice acceptor site probably null
R9072:Mink1 UTSW 11 70,499,207 (GRCm39) missense possibly damaging 0.86
R9073:Mink1 UTSW 11 70,499,207 (GRCm39) missense possibly damaging 0.86
R9324:Mink1 UTSW 11 70,502,477 (GRCm39) missense probably damaging 0.98
R9596:Mink1 UTSW 11 70,497,915 (GRCm39) missense possibly damaging 0.96
Predicted Primers PCR Primer
(F):5'- TCCTGGCTTCGGAACAAGATC -3'
(R):5'- ACTGTCAGGTCCACCAGTAG -3'

Sequencing Primer
(F):5'- TGGCTTCGGAACAAGATCCTACAC -3'
(R):5'- TCAGGTCCACCAGTAGAGGGC -3'
Posted On 2014-12-04