Mutagenetix > Incidental Mutation

Incidental Mutation 'R8468:Smarcc2'

656918

Institutional Source

Beutler Lab

Gene Symbol

Smarcc2

Ensembl Gene

ENSMUSG00000025369

Gene Name

SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 2

Synonyms

5930405J04Rik

MMRRC Submission

Accession Numbers

Essential gene?

Probably essential (E-score: 0.816) question?

Stock #

R8468 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

128459248-128490482 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 128484393 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Histidine at position 882 (R882H)

Ref Sequence

ENSEMBL: ENSMUSP00000096734 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000026433] [ENSMUST00000099131] [ENSMUST00000105235] [ENSMUST00000218228]

AlphaFold

Q6PDG5

Predicted Effect

probably benign
Transcript: ENSMUST00000026433
AA Change: R851H

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000026433
Gene: ENSMUSG00000025369
AA Change: R851H

Domain	Start	End	E-Value	Type
low complexity region	48	64	N/A	INTRINSIC
CHROMO	186	235	5.97e-6	SMART
low complexity region	297	307	N/A	INTRINSIC
Pfam:SWIRM	424	512	4.9e-38	PFAM
low complexity region	545	557	N/A	INTRINSIC
SANT	597	645	9.04e-12	SMART
low complexity region	768	816	N/A	INTRINSIC
low complexity region	861	879	N/A	INTRINSIC
coiled coil region	906	921	N/A	INTRINSIC
low complexity region	948	982	N/A	INTRINSIC
low complexity region	985	1010	N/A	INTRINSIC
low complexity region	1012	1062	N/A	INTRINSIC
low complexity region	1074	1098	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000099131
AA Change: R882H

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000096734
Gene: ENSMUSG00000025369
AA Change: R882H

Domain	Start	End	E-Value	Type
low complexity region	48	64	N/A	INTRINSIC
CHROMO	186	235	5.97e-6	SMART
low complexity region	297	307	N/A	INTRINSIC
Pfam:SWIRM	424	512	3.9e-38	PFAM
SANT	628	676	9.04e-12	SMART
low complexity region	799	847	N/A	INTRINSIC
low complexity region	892	910	N/A	INTRINSIC
coiled coil region	937	952	N/A	INTRINSIC
low complexity region	979	1013	N/A	INTRINSIC
low complexity region	1016	1041	N/A	INTRINSIC
low complexity region	1043	1093	N/A	INTRINSIC
low complexity region	1105	1129	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000105235
AA Change: R851H

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000100868
Gene: ENSMUSG00000025369
AA Change: R851H

Domain	Start	End	E-Value	Type
low complexity region	48	64	N/A	INTRINSIC
CHROMO	186	235	5.97e-6	SMART
low complexity region	297	307	N/A	INTRINSIC
Pfam:SWIRM	426	512	4.5e-35	PFAM
low complexity region	545	557	N/A	INTRINSIC
SANT	597	645	9.04e-12	SMART
Pfam:SWIRM-assoc_3	684	750	4.1e-34	PFAM
low complexity region	768	816	N/A	INTRINSIC
Pfam:SWIRM-assoc_1	863	946	1.5e-34	PFAM
low complexity region	948	982	N/A	INTRINSIC
low complexity region	985	1010	N/A	INTRINSIC
low complexity region	1012	1062	N/A	INTRINSIC
low complexity region	1077	1093	N/A	INTRINSIC
low complexity region	1108	1123	N/A	INTRINSIC
low complexity region	1153	1177	N/A	INTRINSIC
low complexity region	1184	1212	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000218228

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

100% (36/36)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the SWI/SNF family of proteins, whose members display helicase and ATPase activities and which are thought to regulate transcription of certain genes by altering the chromatin structure around those genes. The encoded protein is part of the large ATP-dependent chromatin remodeling complex SNF/SWI and contains a predicted leucine zipper motif typical of many transcription factors. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted allele exhibit a slight increase in embryo weight at E13.5 and die shortly after birth (P0-P3). Mice homozygous for a conditional allele activated in the brain exhibit reduced cerebral cortical size and thickness. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 37 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamts1	A	G	16: 85,795,556	W655R	possibly damaging	Het
Adamts3	C	T	5: 89,694,768	A748T	probably benign	Het
Ano1	A	C	7: 144,655,620	F248C	probably damaging	Het
Ap2b1	T	A	11: 83,351,065	L628Q	probably damaging	Het
BC035947	C	A	1: 78,498,330	A522S	probably damaging	Het
Bdp1	A	G	13: 100,060,568	V1103A	probably benign	Het
Cd248	T	A	19: 5,069,882	I586N	possibly damaging	Het
Dnah9	C	A	11: 65,831,730	M4428I	probably benign	Het
Epha5	T	C	5: 84,142,416		probably null	Het
Fan1	T	A	7: 64,372,486	N340Y	probably damaging	Het
Fastkd2	T	A	1: 63,731,764	L93Q	probably benign	Het
Gm6665	T	C	18: 31,820,400	D5G	possibly damaging	Het
Gphn	T	C	12: 78,226,827	V17A	probably benign	Het
Gpr85	A	T	6: 13,836,296	L203H	probably damaging	Het
Grk6	A	G	13: 55,451,385	Y166C	probably damaging	Het
Ints3	A	G	3: 90,406,253	V356A	probably damaging	Het
Krt33b	G	A	11: 100,029,789	R13C	probably damaging	Het
Lgals3	A	G	14: 47,381,647	I146V	possibly damaging	Het
Lrp1	G	A	10: 127,558,650	R2565C	probably damaging	Het
Miip	G	T	4: 147,861,471	D325E	probably damaging	Het
Naaladl1	T	A	19: 6,108,585	V249E	probably damaging	Het
Nfxl1	C	T	5: 72,518,205	R811K	possibly damaging	Het
Olfr1145	T	C	2: 87,810,738	I306T	possibly damaging	Het
Olfr676	A	T	7: 105,035,746	I183F	probably damaging	Het
Olfr681	A	G	7: 105,121,478	D7G	probably benign	Het
Olfr701	A	G	7: 106,818,839	Y252C	possibly damaging	Het
Olfr822	C	T	10: 130,074,434	T8I	probably benign	Het
Olfr994	T	A	2: 85,430,178	Y217F	probably damaging	Het
Pkd2l2	A	G	18: 34,427,411	D357G	possibly damaging	Het
Ppp1r36	A	G	12: 76,436,205	Y189C	probably damaging	Het
Rev3l	A	G	10: 39,827,991	E2011G	probably damaging	Het
Sestd1	T	A	2: 77,191,746	T534S	probably benign	Het
Sfmbt1	G	A	14: 30,773,984	A75T	probably benign	Het
Son	CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC	CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC	16: 91,656,691		probably benign	Het
Speg	C	T	1: 75,431,309	A3216V	probably damaging	Het
Vmn1r12	A	G	6: 57,159,385	T112A	probably benign	Het
Zfp937	T	G	2: 150,238,714	D221E	probably benign	Het

Other mutations in Smarcc2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00496:Smarcc2	APN	10	128463055	missense	probably damaging	0.97
IGL01450:Smarcc2	APN	10	128469320	missense	probably damaging	1.00
IGL01638:Smarcc2	APN	10	128488074	unclassified	probably benign
IGL01663:Smarcc2	APN	10	128488977	unclassified	probably benign
IGL02308:Smarcc2	APN	10	128482772	missense	probably damaging	1.00
IGL02511:Smarcc2	APN	10	128461382	missense	probably damaging	1.00
IGL02633:Smarcc2	APN	10	128469687	missense	probably damaging	1.00
IGL03375:Smarcc2	APN	10	128482912	missense	probably damaging	0.99
IGL03493:Smarcc2	APN	10	128461357	missense	probably damaging	1.00
PIT4403001:Smarcc2	UTSW	10	128463024	missense	probably damaging	1.00
R0220:Smarcc2	UTSW	10	128483636	missense	probably benign	0.32
R0281:Smarcc2	UTSW	10	128474722	missense	probably benign	0.20
R1299:Smarcc2	UTSW	10	128461378	missense	probably damaging	1.00
R1447:Smarcc2	UTSW	10	128469791	critical splice donor site	probably null
R1466:Smarcc2	UTSW	10	128474245	missense	probably damaging	0.98
R1466:Smarcc2	UTSW	10	128474245	missense	probably damaging	0.98
R1498:Smarcc2	UTSW	10	128482192	missense	probably benign	0.02
R1499:Smarcc2	UTSW	10	128463872	missense	probably damaging	0.99
R1616:Smarcc2	UTSW	10	128482793	missense	probably damaging	1.00
R1718:Smarcc2	UTSW	10	128468998	intron	probably benign
R1767:Smarcc2	UTSW	10	128469082	missense	possibly damaging	0.92
R1792:Smarcc2	UTSW	10	128463871	missense	probably damaging	1.00
R1965:Smarcc2	UTSW	10	128474758	missense	probably damaging	1.00
R2229:Smarcc2	UTSW	10	128488341	unclassified	probably benign
R2286:Smarcc2	UTSW	10	128463743	missense	possibly damaging	0.58
R2367:Smarcc2	UTSW	10	128482167	missense	possibly damaging	0.86
R2398:Smarcc2	UTSW	10	128469682	missense	possibly damaging	0.92
R3084:Smarcc2	UTSW	10	128488159	unclassified	probably benign
R3085:Smarcc2	UTSW	10	128488159	unclassified	probably benign
R3777:Smarcc2	UTSW	10	128482943	critical splice donor site	probably null
R4346:Smarcc2	UTSW	10	128468823	missense	probably benign	0.02
R4967:Smarcc2	UTSW	10	128483180	missense	probably damaging	0.99
R4992:Smarcc2	UTSW	10	128474710	missense	probably damaging	0.99
R5028:Smarcc2	UTSW	10	128461445	missense	probably damaging	0.99
R5071:Smarcc2	UTSW	10	128463940	missense	probably damaging	1.00
R5095:Smarcc2	UTSW	10	128469300	missense	probably damaging	0.99
R5133:Smarcc2	UTSW	10	128461473	critical splice donor site	probably null
R5180:Smarcc2	UTSW	10	128487362	unclassified	probably benign
R5231:Smarcc2	UTSW	10	128461352	missense	probably damaging	1.00
R5240:Smarcc2	UTSW	10	128481006	critical splice donor site	probably null
R5401:Smarcc2	UTSW	10	128465504	missense	probably damaging	1.00
R5445:Smarcc2	UTSW	10	128488074	unclassified	probably benign
R5690:Smarcc2	UTSW	10	128484407	missense	probably damaging	1.00
R5694:Smarcc2	UTSW	10	128484127	missense	probably benign
R6240:Smarcc2	UTSW	10	128488024	unclassified	probably benign
R6545:Smarcc2	UTSW	10	128484128	missense	probably benign	0.00
R6713:Smarcc2	UTSW	10	128487769	splice site	probably null
R6934:Smarcc2	UTSW	10	128469672	missense	probably benign	0.27
R7016:Smarcc2	UTSW	10	128485329	splice site	probably null
R7149:Smarcc2	UTSW	10	128482729	missense	probably damaging	1.00
R7229:Smarcc2	UTSW	10	128488048	missense	unknown
R7395:Smarcc2	UTSW	10	128485606	missense	probably damaging	1.00
R7596:Smarcc2	UTSW	10	128482793	missense	probably damaging	1.00
R7722:Smarcc2	UTSW	10	128481728	missense	possibly damaging	0.72
R8407:Smarcc2	UTSW	10	128482321	missense	probably damaging	1.00
R8753:Smarcc2	UTSW	10	128483201	missense	probably damaging	1.00
R9023:Smarcc2	UTSW	10	128465224	missense	probably damaging	0.98
R9325:Smarcc2	UTSW	10	128488207	missense	unknown
R9327:Smarcc2	UTSW	10	128485617	missense	probably damaging	1.00
R9331:Smarcc2	UTSW	10	128487441	missense	unknown
R9686:Smarcc2	UTSW	10	128480906	missense	probably damaging	1.00
R9742:Smarcc2	UTSW	10	128461353	missense	probably damaging	1.00
Z1088:Smarcc2	UTSW	10	128461434	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGGAACTACAGGAACCACGG -3'
(R):5'- GGGCTATACAGAGAAACCCTGTC -3'

Sequencing Primer
(F):5'- ATAGGTGAGCATCGGCCTC -3'
(R):5'- GTTTGGTGATAACTCACTCAG -3'

Posted On

2021-01-18