Incidental Mutation 'R8468:Gpr85'
ID 656909
Institutional Source Beutler Lab
Gene Symbol Gpr85
Ensembl Gene ENSMUSG00000048216
Gene Name G protein-coupled receptor 85
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.267) question?
Stock # R8468 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 13834458-13839942 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 13836296 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Histidine at position 203 (L203H)
Ref Sequence ENSEMBL: ENSMUSP00000111155 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060442] [ENSMUST00000115491] [ENSMUST00000115492]
AlphaFold P60894
Predicted Effect probably damaging
Transcript: ENSMUST00000060442
AA Change: L203H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000053837
Gene: ENSMUSG00000048216
AA Change: L203H

DomainStartEndE-ValueType
Pfam:7tm_1 37 338 4.1e-38 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000115491
AA Change: L203H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000111154
Gene: ENSMUSG00000048216
AA Change: L203H

DomainStartEndE-ValueType
Pfam:7tm_1 37 338 4.1e-38 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000115492
AA Change: L203H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000111155
Gene: ENSMUSG00000048216
AA Change: L203H

DomainStartEndE-ValueType
Pfam:7tm_1 37 338 1.6e-32 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (36/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the G protein-coupled receptor (GPCR) family, such as GPR85, have a similar structure characterized by 7 transmembrane domains. Activation of GPCRs by extracellular stimuli, such as neurotransmitters, hormones, or light, induces an intracellular signaling cascade mediated by heterotrimeric GTP-binding proteins, or G proteins (Matsumoto et al., 2000 [PubMed 10833454]).[supplied by OMIM, Aug 2008]
PHENOTYPE: Mice homozygous for a knock-out allele display a significant increase in brain weight and enhanced contextual memory in a fear-conditioning task but no additional behavioral abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts1 A G 16: 85,795,556 W655R possibly damaging Het
Adamts3 C T 5: 89,694,768 A748T probably benign Het
Ano1 A C 7: 144,655,620 F248C probably damaging Het
Ap2b1 T A 11: 83,351,065 L628Q probably damaging Het
BC035947 C A 1: 78,498,330 A522S probably damaging Het
Bdp1 A G 13: 100,060,568 V1103A probably benign Het
Cd248 T A 19: 5,069,882 I586N possibly damaging Het
Dnah9 C A 11: 65,831,730 M4428I probably benign Het
Epha5 T C 5: 84,142,416 probably null Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fastkd2 T A 1: 63,731,764 L93Q probably benign Het
Gm6665 T C 18: 31,820,400 D5G possibly damaging Het
Gphn T C 12: 78,226,827 V17A probably benign Het
Grk6 A G 13: 55,451,385 Y166C probably damaging Het
Ints3 A G 3: 90,406,253 V356A probably damaging Het
Krt33b G A 11: 100,029,789 R13C probably damaging Het
Lgals3 A G 14: 47,381,647 I146V possibly damaging Het
Lrp1 G A 10: 127,558,650 R2565C probably damaging Het
Miip G T 4: 147,861,471 D325E probably damaging Het
Naaladl1 T A 19: 6,108,585 V249E probably damaging Het
Nfxl1 C T 5: 72,518,205 R811K possibly damaging Het
Olfr1145 T C 2: 87,810,738 I306T possibly damaging Het
Olfr676 A T 7: 105,035,746 I183F probably damaging Het
Olfr681 A G 7: 105,121,478 D7G probably benign Het
Olfr701 A G 7: 106,818,839 Y252C possibly damaging Het
Olfr822 C T 10: 130,074,434 T8I probably benign Het
Olfr994 T A 2: 85,430,178 Y217F probably damaging Het
Pkd2l2 A G 18: 34,427,411 D357G possibly damaging Het
Ppp1r36 A G 12: 76,436,205 Y189C probably damaging Het
Rev3l A G 10: 39,827,991 E2011G probably damaging Het
Sestd1 T A 2: 77,191,746 T534S probably benign Het
Sfmbt1 G A 14: 30,773,984 A75T probably benign Het
Smarcc2 G A 10: 128,484,393 R882H probably benign Het
Son CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC 16: 91,656,691 probably benign Het
Speg C T 1: 75,431,309 A3216V probably damaging Het
Vmn1r12 A G 6: 57,159,385 T112A probably benign Het
Zfp937 T G 2: 150,238,714 D221E probably benign Het
Other mutations in Gpr85
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02414:Gpr85 APN 6 13836910 utr 5 prime probably benign
R0784:Gpr85 UTSW 6 13836749 missense probably benign 0.25
R1356:Gpr85 UTSW 6 13836147 missense probably benign 0.42
R2343:Gpr85 UTSW 6 13836696 missense probably damaging 1.00
R3934:Gpr85 UTSW 6 13836045 missense probably benign 0.02
R3935:Gpr85 UTSW 6 13836045 missense probably benign 0.02
R3936:Gpr85 UTSW 6 13836045 missense probably benign 0.02
R4925:Gpr85 UTSW 6 13835978 missense probably benign 0.26
R5313:Gpr85 UTSW 6 13836302 missense probably damaging 1.00
R5586:Gpr85 UTSW 6 13836001 nonsense probably null
R7043:Gpr85 UTSW 6 13835877 missense probably damaging 1.00
R8458:Gpr85 UTSW 6 13836849 missense probably benign
R8503:Gpr85 UTSW 6 13836830 missense probably benign 0.01
R9519:Gpr85 UTSW 6 13836999 start gained probably benign
Predicted Primers PCR Primer
(F):5'- CATTTTGCCTGATGCCCAGC -3'
(R):5'- ACCGCTTCTATACAAAGAGGC -3'

Sequencing Primer
(F):5'- TGATGCCCAGCAAGGTG -3'
(R):5'- GCTTCTATACAAAGAGGCTGACC -3'
Posted On 2021-01-18