Incidental Mutation 'R8468:Olfr701'
ID 656914
Institutional Source Beutler Lab
Gene Symbol Olfr701
Ensembl Gene ENSMUSG00000036744
Gene Name olfactory receptor 701
Synonyms 4933433E02Rik, MOR283-1, GA_x6K02T2PBJ9-9195805-9196755, 4932441H21Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.125) question?
Stock # R8468 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 106814129-106821472 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 106818839 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 252 (Y252C)
Ref Sequence ENSEMBL: ENSMUSP00000151783 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075414] [ENSMUST00000080899] [ENSMUST00000166880] [ENSMUST00000217739] [ENSMUST00000219803]
AlphaFold Q9D3U9
Predicted Effect possibly damaging
Transcript: ENSMUST00000075414
AA Change: Y252C

PolyPhen 2 Score 0.660 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000074868
Gene: ENSMUSG00000036744
AA Change: Y252C

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 2.9e-46 PFAM
Pfam:7tm_1 41 290 2.3e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000080899
SMART Domains Protein: ENSMUSP00000079704
Gene: ENSMUSG00000056863

DomainStartEndE-ValueType
Pfam:7tm_4 29 307 2.7e-53 PFAM
Pfam:7TM_GPCR_Srsx 35 300 2.9e-8 PFAM
Pfam:7tm_1 41 290 1.5e-26 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000166880
AA Change: Y252C

PolyPhen 2 Score 0.660 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000130958
Gene: ENSMUSG00000036744
AA Change: Y252C

DomainStartEndE-ValueType
Pfam:7tm_1 41 290 5.8e-31 PFAM
Pfam:7tm_4 139 283 1.8e-44 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000217739
AA Change: Y252C

PolyPhen 2 Score 0.660 (Sensitivity: 0.86; Specificity: 0.91)
Predicted Effect probably benign
Transcript: ENSMUST00000219803
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (36/36)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts1 A G 16: 85,795,556 W655R possibly damaging Het
Adamts3 C T 5: 89,694,768 A748T probably benign Het
Ano1 A C 7: 144,655,620 F248C probably damaging Het
Ap2b1 T A 11: 83,351,065 L628Q probably damaging Het
BC035947 C A 1: 78,498,330 A522S probably damaging Het
Bdp1 A G 13: 100,060,568 V1103A probably benign Het
Cd248 T A 19: 5,069,882 I586N possibly damaging Het
Dnah9 C A 11: 65,831,730 M4428I probably benign Het
Epha5 T C 5: 84,142,416 probably null Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fastkd2 T A 1: 63,731,764 L93Q probably benign Het
Gm6665 T C 18: 31,820,400 D5G possibly damaging Het
Gphn T C 12: 78,226,827 V17A probably benign Het
Gpr85 A T 6: 13,836,296 L203H probably damaging Het
Grk6 A G 13: 55,451,385 Y166C probably damaging Het
Ints3 A G 3: 90,406,253 V356A probably damaging Het
Krt33b G A 11: 100,029,789 R13C probably damaging Het
Lgals3 A G 14: 47,381,647 I146V possibly damaging Het
Lrp1 G A 10: 127,558,650 R2565C probably damaging Het
Miip G T 4: 147,861,471 D325E probably damaging Het
Naaladl1 T A 19: 6,108,585 V249E probably damaging Het
Nfxl1 C T 5: 72,518,205 R811K possibly damaging Het
Olfr1145 T C 2: 87,810,738 I306T possibly damaging Het
Olfr676 A T 7: 105,035,746 I183F probably damaging Het
Olfr681 A G 7: 105,121,478 D7G probably benign Het
Olfr822 C T 10: 130,074,434 T8I probably benign Het
Olfr994 T A 2: 85,430,178 Y217F probably damaging Het
Pkd2l2 A G 18: 34,427,411 D357G possibly damaging Het
Ppp1r36 A G 12: 76,436,205 Y189C probably damaging Het
Rev3l A G 10: 39,827,991 E2011G probably damaging Het
Sestd1 T A 2: 77,191,746 T534S probably benign Het
Sfmbt1 G A 14: 30,773,984 A75T probably benign Het
Smarcc2 G A 10: 128,484,393 R882H probably benign Het
Son CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC 16: 91,656,691 probably benign Het
Speg C T 1: 75,431,309 A3216V probably damaging Het
Vmn1r12 A G 6: 57,159,385 T112A probably benign Het
Zfp937 T G 2: 150,238,714 D221E probably benign Het
Other mutations in Olfr701
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01476:Olfr701 APN 7 106818620 missense probably damaging 1.00
IGL01972:Olfr701 APN 7 106818532 missense probably benign 0.01
IGL02541:Olfr701 APN 7 106818602 missense probably benign 0.34
R0276:Olfr701 UTSW 7 106818697 missense probably benign 0.00
R0345:Olfr701 UTSW 7 106818701 missense probably benign 0.38
R0467:Olfr701 UTSW 7 106818361 missense possibly damaging 0.49
R1829:Olfr701 UTSW 7 106819007 missense probably benign
R3116:Olfr701 UTSW 7 106818364 missense probably damaging 0.98
R3870:Olfr701 UTSW 7 106818840 nonsense probably null
R5267:Olfr701 UTSW 7 106818808 missense probably damaging 1.00
R6036:Olfr701 UTSW 7 106818460 missense probably damaging 1.00
R6036:Olfr701 UTSW 7 106818460 missense probably damaging 1.00
R7229:Olfr701 UTSW 7 106818995 missense probably damaging 0.97
R7230:Olfr701 UTSW 7 106818179 missense possibly damaging 0.78
R7231:Olfr701 UTSW 7 106818443 missense probably damaging 1.00
R7419:Olfr701 UTSW 7 106818344 missense possibly damaging 0.89
R7537:Olfr701 UTSW 7 106818374 missense probably damaging 1.00
R9246:Olfr701 UTSW 7 106818731 missense probably benign 0.00
R9300:Olfr701 UTSW 7 106818904 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TTGAAATTGGCTTGTGCAGAC -3'
(R):5'- CATCCTAAACAGTGGCGTGTG -3'

Sequencing Primer
(F):5'- GACACATCTCAATATGAGCTCATGG -3'
(R):5'- GTGCTGGCAGAATATGTCTCCC -3'
Posted On 2021-01-18