Incidental Mutation 'R8468:Miip'
ID 656906
Institutional Source Beutler Lab
Gene Symbol Miip
Ensembl Gene ENSMUSG00000029022
Gene Name migration and invasion inhibitory protein
Synonyms D4Wsu114e
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock # R8468 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 147860778-147868816 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 147861471 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 325 (D325E)
Ref Sequence ENSEMBL: ENSMUSP00000113897 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030886] [ENSMUST00000119975] [ENSMUST00000172710]
AlphaFold A2A7Y5
Predicted Effect probably damaging
Transcript: ENSMUST00000030886
AA Change: D325E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000030886
Gene: ENSMUSG00000029022
AA Change: D325E

DomainStartEndE-ValueType
low complexity region 13 24 N/A INTRINSIC
low complexity region 60 69 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000119975
AA Change: D325E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113897
Gene: ENSMUSG00000029022
AA Change: D325E

DomainStartEndE-ValueType
low complexity region 13 24 N/A INTRINSIC
Pfam:MIIP 41 382 1.4e-142 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000172710
AA Change: D325E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000134085
Gene: ENSMUSG00000029022
AA Change: D325E

DomainStartEndE-ValueType
low complexity region 13 24 N/A INTRINSIC
low complexity region 60 69 N/A INTRINSIC
Meta Mutation Damage Score 0.4244 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (36/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that interacts with the oncogene protein insulin-like growth factor binding protein 2 and may function as an inhibitor of cell migration and invasion. This protein also interacts with the cell division protein 20 and may be involved in regulating mitotic progression. This protein may function as a tumor suppressor by inhibiting the growth or certain cancers. [provided by RefSeq, Sep 2011]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts1 A G 16: 85,795,556 W655R possibly damaging Het
Adamts3 C T 5: 89,694,768 A748T probably benign Het
Ano1 A C 7: 144,655,620 F248C probably damaging Het
Ap2b1 T A 11: 83,351,065 L628Q probably damaging Het
BC035947 C A 1: 78,498,330 A522S probably damaging Het
Bdp1 A G 13: 100,060,568 V1103A probably benign Het
Cd248 T A 19: 5,069,882 I586N possibly damaging Het
Dnah9 C A 11: 65,831,730 M4428I probably benign Het
Epha5 T C 5: 84,142,416 probably null Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fastkd2 T A 1: 63,731,764 L93Q probably benign Het
Gm6665 T C 18: 31,820,400 D5G possibly damaging Het
Gphn T C 12: 78,226,827 V17A probably benign Het
Gpr85 A T 6: 13,836,296 L203H probably damaging Het
Grk6 A G 13: 55,451,385 Y166C probably damaging Het
Ints3 A G 3: 90,406,253 V356A probably damaging Het
Krt33b G A 11: 100,029,789 R13C probably damaging Het
Lgals3 A G 14: 47,381,647 I146V possibly damaging Het
Lrp1 G A 10: 127,558,650 R2565C probably damaging Het
Naaladl1 T A 19: 6,108,585 V249E probably damaging Het
Nfxl1 C T 5: 72,518,205 R811K possibly damaging Het
Olfr1145 T C 2: 87,810,738 I306T possibly damaging Het
Olfr676 A T 7: 105,035,746 I183F probably damaging Het
Olfr681 A G 7: 105,121,478 D7G probably benign Het
Olfr701 A G 7: 106,818,839 Y252C possibly damaging Het
Olfr822 C T 10: 130,074,434 T8I probably benign Het
Olfr994 T A 2: 85,430,178 Y217F probably damaging Het
Pkd2l2 A G 18: 34,427,411 D357G possibly damaging Het
Ppp1r36 A G 12: 76,436,205 Y189C probably damaging Het
Rev3l A G 10: 39,827,991 E2011G probably damaging Het
Sestd1 T A 2: 77,191,746 T534S probably benign Het
Sfmbt1 G A 14: 30,773,984 A75T probably benign Het
Smarcc2 G A 10: 128,484,393 R882H probably benign Het
Son CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC 16: 91,656,691 probably benign Het
Speg C T 1: 75,431,309 A3216V probably damaging Het
Vmn1r12 A G 6: 57,159,385 T112A probably benign Het
Zfp937 T G 2: 150,238,714 D221E probably benign Het
Other mutations in Miip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00531:Miip APN 4 147865865 missense probably damaging 1.00
IGL02134:Miip APN 4 147865278 splice site probably benign
IGL02829:Miip APN 4 147863061 missense probably benign 0.01
IGL03350:Miip APN 4 147862522 missense probably benign 0.01
R0200:Miip UTSW 4 147862263 missense probably damaging 0.99
R1647:Miip UTSW 4 147865234 missense probably benign 0.02
R1783:Miip UTSW 4 147865774 missense probably damaging 1.00
R1848:Miip UTSW 4 147863092 missense probably damaging 0.99
R1944:Miip UTSW 4 147865965 missense probably benign 0.15
R3615:Miip UTSW 4 147865914 missense probably benign 0.00
R3616:Miip UTSW 4 147865914 missense probably benign 0.00
R3882:Miip UTSW 4 147861052 missense possibly damaging 0.93
R4579:Miip UTSW 4 147861061 missense probably damaging 1.00
R5183:Miip UTSW 4 147863069 missense probably damaging 1.00
R6054:Miip UTSW 4 147865678 missense probably benign 0.00
R6056:Miip UTSW 4 147862335 missense probably damaging 1.00
R6304:Miip UTSW 4 147863083 missense probably benign 0.12
R6568:Miip UTSW 4 147865915 missense probably benign
R6603:Miip UTSW 4 147865923 missense possibly damaging 0.92
R7639:Miip UTSW 4 147862564 missense probably benign 0.22
R7701:Miip UTSW 4 147862914 missense probably null 0.86
R7795:Miip UTSW 4 147862918 missense probably benign 0.17
R7796:Miip UTSW 4 147862918 missense probably benign 0.17
R7797:Miip UTSW 4 147862918 missense probably benign 0.17
R7872:Miip UTSW 4 147862918 missense probably benign 0.17
R7920:Miip UTSW 4 147862918 missense probably benign 0.17
R8492:Miip UTSW 4 147861424 missense probably damaging 1.00
R8677:Miip UTSW 4 147863046 missense probably damaging 1.00
R8852:Miip UTSW 4 147866382 start gained probably benign
R8860:Miip UTSW 4 147866382 start gained probably benign
R9755:Miip UTSW 4 147865862 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ATAGGATCTGTCCCACCTGG -3'
(R):5'- TCAAGGCCAAGTCCAACATGG -3'

Sequencing Primer
(F):5'- TGGACACTTTCCCACCCCAG -3'
(R):5'- GAAAGGATTCCATTAATATCCCCATC -3'
Posted On 2021-01-18