Mutagenetix > Incidental Mutation

Incidental Mutation 'R8468:Miip'

656906

Institutional Source

Beutler Lab

Gene Symbol

Miip

Ensembl Gene

ENSMUSG00000029022

Gene Name

migration and invasion inhibitory protein

Synonyms

D4Wsu114e

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.068) question?

Stock #

R8468 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

147860778-147868816 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 147861471 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 325 (D325E)

Ref Sequence

ENSEMBL: ENSMUSP00000113897 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030886] [ENSMUST00000119975] [ENSMUST00000172710]

AlphaFold

A2A7Y5

Predicted Effect

probably damaging
Transcript: ENSMUST00000030886
AA Change: D325E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000030886
Gene: ENSMUSG00000029022
AA Change: D325E

Domain	Start	End	E-Value	Type
low complexity region	13	24	N/A	INTRINSIC
low complexity region	60	69	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000119975
AA Change: D325E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000113897
Gene: ENSMUSG00000029022
AA Change: D325E

Domain	Start	End	E-Value	Type
low complexity region	13	24	N/A	INTRINSIC
Pfam:MIIP	41	382	1.4e-142	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000172710
AA Change: D325E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000134085
Gene: ENSMUSG00000029022
AA Change: D325E

Domain	Start	End	E-Value	Type
low complexity region	13	24	N/A	INTRINSIC
low complexity region	60	69	N/A	INTRINSIC

Meta Mutation Damage Score

0.4244

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

100% (36/36)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that interacts with the oncogene protein insulin-like growth factor binding protein 2 and may function as an inhibitor of cell migration and invasion. This protein also interacts with the cell division protein 20 and may be involved in regulating mitotic progression. This protein may function as a tumor suppressor by inhibiting the growth or certain cancers. [provided by RefSeq, Sep 2011]

Allele List at MGI

Other mutations in this stock

Total: 37 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamts1	A	G	16: 85,795,556	W655R	possibly damaging	Het
Adamts3	C	T	5: 89,694,768	A748T	probably benign	Het
Ano1	A	C	7: 144,655,620	F248C	probably damaging	Het
Ap2b1	T	A	11: 83,351,065	L628Q	probably damaging	Het
BC035947	C	A	1: 78,498,330	A522S	probably damaging	Het
Bdp1	A	G	13: 100,060,568	V1103A	probably benign	Het
Cd248	T	A	19: 5,069,882	I586N	possibly damaging	Het
Dnah9	C	A	11: 65,831,730	M4428I	probably benign	Het
Epha5	T	C	5: 84,142,416		probably null	Het
Fan1	T	A	7: 64,372,486	N340Y	probably damaging	Het
Fastkd2	T	A	1: 63,731,764	L93Q	probably benign	Het
Gm6665	T	C	18: 31,820,400	D5G	possibly damaging	Het
Gphn	T	C	12: 78,226,827	V17A	probably benign	Het
Gpr85	A	T	6: 13,836,296	L203H	probably damaging	Het
Grk6	A	G	13: 55,451,385	Y166C	probably damaging	Het
Ints3	A	G	3: 90,406,253	V356A	probably damaging	Het
Krt33b	G	A	11: 100,029,789	R13C	probably damaging	Het
Lgals3	A	G	14: 47,381,647	I146V	possibly damaging	Het
Lrp1	G	A	10: 127,558,650	R2565C	probably damaging	Het
Naaladl1	T	A	19: 6,108,585	V249E	probably damaging	Het
Nfxl1	C	T	5: 72,518,205	R811K	possibly damaging	Het
Olfr1145	T	C	2: 87,810,738	I306T	possibly damaging	Het
Olfr676	A	T	7: 105,035,746	I183F	probably damaging	Het
Olfr681	A	G	7: 105,121,478	D7G	probably benign	Het
Olfr701	A	G	7: 106,818,839	Y252C	possibly damaging	Het
Olfr822	C	T	10: 130,074,434	T8I	probably benign	Het
Olfr994	T	A	2: 85,430,178	Y217F	probably damaging	Het
Pkd2l2	A	G	18: 34,427,411	D357G	possibly damaging	Het
Ppp1r36	A	G	12: 76,436,205	Y189C	probably damaging	Het
Rev3l	A	G	10: 39,827,991	E2011G	probably damaging	Het
Sestd1	T	A	2: 77,191,746	T534S	probably benign	Het
Sfmbt1	G	A	14: 30,773,984	A75T	probably benign	Het
Smarcc2	G	A	10: 128,484,393	R882H	probably benign	Het
Son	CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC	CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC	16: 91,656,691		probably benign	Het
Speg	C	T	1: 75,431,309	A3216V	probably damaging	Het
Vmn1r12	A	G	6: 57,159,385	T112A	probably benign	Het
Zfp937	T	G	2: 150,238,714	D221E	probably benign	Het

Other mutations in Miip

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00531:Miip	APN	4	147865865	missense	probably damaging	1.00
IGL02134:Miip	APN	4	147865278	splice site	probably benign
IGL02829:Miip	APN	4	147863061	missense	probably benign	0.01
IGL03350:Miip	APN	4	147862522	missense	probably benign	0.01
R0200:Miip	UTSW	4	147862263	missense	probably damaging	0.99
R1647:Miip	UTSW	4	147865234	missense	probably benign	0.02
R1783:Miip	UTSW	4	147865774	missense	probably damaging	1.00
R1848:Miip	UTSW	4	147863092	missense	probably damaging	0.99
R1944:Miip	UTSW	4	147865965	missense	probably benign	0.15
R3615:Miip	UTSW	4	147865914	missense	probably benign	0.00
R3616:Miip	UTSW	4	147865914	missense	probably benign	0.00
R3882:Miip	UTSW	4	147861052	missense	possibly damaging	0.93
R4579:Miip	UTSW	4	147861061	missense	probably damaging	1.00
R5183:Miip	UTSW	4	147863069	missense	probably damaging	1.00
R6054:Miip	UTSW	4	147865678	missense	probably benign	0.00
R6056:Miip	UTSW	4	147862335	missense	probably damaging	1.00
R6304:Miip	UTSW	4	147863083	missense	probably benign	0.12
R6568:Miip	UTSW	4	147865915	missense	probably benign
R6603:Miip	UTSW	4	147865923	missense	possibly damaging	0.92
R7639:Miip	UTSW	4	147862564	missense	probably benign	0.22
R7701:Miip	UTSW	4	147862914	missense	probably null	0.86
R7795:Miip	UTSW	4	147862918	missense	probably benign	0.17
R7796:Miip	UTSW	4	147862918	missense	probably benign	0.17
R7797:Miip	UTSW	4	147862918	missense	probably benign	0.17
R7872:Miip	UTSW	4	147862918	missense	probably benign	0.17
R7920:Miip	UTSW	4	147862918	missense	probably benign	0.17
R8492:Miip	UTSW	4	147861424	missense	probably damaging	1.00
R8677:Miip	UTSW	4	147863046	missense	probably damaging	1.00
R8852:Miip	UTSW	4	147866382	start gained	probably benign
R8860:Miip	UTSW	4	147866382	start gained	probably benign
R9755:Miip	UTSW	4	147865862	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- ATAGGATCTGTCCCACCTGG -3'
(R):5'- TCAAGGCCAAGTCCAACATGG -3'

Sequencing Primer
(F):5'- TGGACACTTTCCCACCCCAG -3'
(R):5'- GAAAGGATTCCATTAATATCCCCATC -3'

Posted On

2021-01-18