Incidental Mutation 'R8468:Nfxl1'
ID 656907
Institutional Source Beutler Lab
Gene Symbol Nfxl1
Ensembl Gene ENSMUSG00000072889
Gene Name nuclear transcription factor, X-box binding-like 1
Synonyms 1700012H24Rik, TCF9, D430033A06Rik, LOC381696
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.161) question?
Stock # R8468 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 72513301-72559684 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 72518205 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Lysine at position 811 (R811K)
Ref Sequence ENSEMBL: ENSMUSP00000084467 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087216] [ENSMUST00000135318]
AlphaFold E9Q8I7
Predicted Effect possibly damaging
Transcript: ENSMUST00000087216
AA Change: R811K

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000084467
Gene: ENSMUSG00000072889
AA Change: R811K

DomainStartEndE-ValueType
low complexity region 9 19 N/A INTRINSIC
low complexity region 25 64 N/A INTRINSIC
low complexity region 106 125 N/A INTRINSIC
low complexity region 134 142 N/A INTRINSIC
RING 167 226 4.99e-1 SMART
ZnF_NFX 272 290 2.83e-3 SMART
ZnF_NFX 325 344 1.42e-3 SMART
ZnF_NFX 378 397 2.88e-4 SMART
ZnF_NFX 431 450 5.01e-4 SMART
ZnF_NFX 458 479 1.67e2 SMART
ZnF_NFX 483 502 9.71e-2 SMART
ZnF_NFX 510 529 3.49e-3 SMART
ZnF_NFX 567 587 4.56e1 SMART
Pfam:zf-NF-X1 596 608 6.8e-3 PFAM
ZnF_NFX 677 710 4.23e1 SMART
ZnF_NFX 720 738 5.49e-1 SMART
ZnF_NFX 782 801 1.63e-3 SMART
coiled coil region 829 880 N/A INTRINSIC
transmembrane domain 897 914 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000135318
SMART Domains Protein: ENSMUSP00000114355
Gene: ENSMUSG00000072889

DomainStartEndE-ValueType
low complexity region 9 19 N/A INTRINSIC
low complexity region 25 64 N/A INTRINSIC
low complexity region 106 125 N/A INTRINSIC
low complexity region 134 142 N/A INTRINSIC
RING 167 226 4.99e-1 SMART
ZnF_NFX 272 290 2.83e-3 SMART
ZnF_NFX 325 344 1.42e-3 SMART
ZnF_NFX 378 397 2.88e-4 SMART
ZnF_NFX 431 450 5.01e-4 SMART
ZnF_NFX 458 479 1.67e2 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (36/36)
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts1 A G 16: 85,795,556 W655R possibly damaging Het
Adamts3 C T 5: 89,694,768 A748T probably benign Het
Ano1 A C 7: 144,655,620 F248C probably damaging Het
Ap2b1 T A 11: 83,351,065 L628Q probably damaging Het
BC035947 C A 1: 78,498,330 A522S probably damaging Het
Bdp1 A G 13: 100,060,568 V1103A probably benign Het
Cd248 T A 19: 5,069,882 I586N possibly damaging Het
Dnah9 C A 11: 65,831,730 M4428I probably benign Het
Epha5 T C 5: 84,142,416 probably null Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fastkd2 T A 1: 63,731,764 L93Q probably benign Het
Gm6665 T C 18: 31,820,400 D5G possibly damaging Het
Gphn T C 12: 78,226,827 V17A probably benign Het
Gpr85 A T 6: 13,836,296 L203H probably damaging Het
Grk6 A G 13: 55,451,385 Y166C probably damaging Het
Ints3 A G 3: 90,406,253 V356A probably damaging Het
Krt33b G A 11: 100,029,789 R13C probably damaging Het
Lgals3 A G 14: 47,381,647 I146V possibly damaging Het
Lrp1 G A 10: 127,558,650 R2565C probably damaging Het
Miip G T 4: 147,861,471 D325E probably damaging Het
Naaladl1 T A 19: 6,108,585 V249E probably damaging Het
Olfr1145 T C 2: 87,810,738 I306T possibly damaging Het
Olfr676 A T 7: 105,035,746 I183F probably damaging Het
Olfr681 A G 7: 105,121,478 D7G probably benign Het
Olfr701 A G 7: 106,818,839 Y252C possibly damaging Het
Olfr822 C T 10: 130,074,434 T8I probably benign Het
Olfr994 T A 2: 85,430,178 Y217F probably damaging Het
Pkd2l2 A G 18: 34,427,411 D357G possibly damaging Het
Ppp1r36 A G 12: 76,436,205 Y189C probably damaging Het
Rev3l A G 10: 39,827,991 E2011G probably damaging Het
Sestd1 T A 2: 77,191,746 T534S probably benign Het
Sfmbt1 G A 14: 30,773,984 A75T probably benign Het
Smarcc2 G A 10: 128,484,393 R882H probably benign Het
Son CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC 16: 91,656,691 probably benign Het
Speg C T 1: 75,431,309 A3216V probably damaging Het
Vmn1r12 A G 6: 57,159,385 T112A probably benign Het
Zfp937 T G 2: 150,238,714 D221E probably benign Het
Other mutations in Nfxl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01094:Nfxl1 APN 5 72550428 splice site probably benign
IGL01716:Nfxl1 APN 5 72540934 missense probably damaging 1.00
IGL02592:Nfxl1 APN 5 72514229 missense probably benign 0.25
IGL03083:Nfxl1 APN 5 72540662 splice site probably benign
FR4548:Nfxl1 UTSW 5 72559115 small insertion probably benign
FR4737:Nfxl1 UTSW 5 72559121 small insertion probably benign
R0478:Nfxl1 UTSW 5 72524645 critical splice donor site probably null
R0725:Nfxl1 UTSW 5 72559130 missense probably benign
R1374:Nfxl1 UTSW 5 72524145 missense probably benign 0.04
R1616:Nfxl1 UTSW 5 72529037 missense probably benign 0.01
R1752:Nfxl1 UTSW 5 72540875 missense probably damaging 1.00
R2108:Nfxl1 UTSW 5 72514332 critical splice acceptor site probably null
R3081:Nfxl1 UTSW 5 72529035 missense possibly damaging 0.92
R3693:Nfxl1 UTSW 5 72540611 missense probably damaging 0.99
R3725:Nfxl1 UTSW 5 72517062 missense probably damaging 1.00
R4660:Nfxl1 UTSW 5 72552668 missense probably damaging 1.00
R5058:Nfxl1 UTSW 5 72556239 missense probably benign 0.03
R5406:Nfxl1 UTSW 5 72556198 missense possibly damaging 0.92
R5447:Nfxl1 UTSW 5 72529169 missense probably benign 0.01
R5634:Nfxl1 UTSW 5 72529490 missense probably damaging 1.00
R5831:Nfxl1 UTSW 5 72522197 missense probably benign
R5910:Nfxl1 UTSW 5 72540365 missense probably benign 0.05
R6086:Nfxl1 UTSW 5 72541019 missense probably benign 0.39
R6091:Nfxl1 UTSW 5 72514190 missense probably benign 0.00
R6212:Nfxl1 UTSW 5 72516210 critical splice donor site probably null
R6501:Nfxl1 UTSW 5 72528509 splice site probably null
R6521:Nfxl1 UTSW 5 72540308 splice site probably null
R7283:Nfxl1 UTSW 5 72529050 missense probably benign
R7426:Nfxl1 UTSW 5 72524174 nonsense probably null
R7480:Nfxl1 UTSW 5 72559252 nonsense probably null
R7648:Nfxl1 UTSW 5 72523536 missense probably benign 0.12
R7817:Nfxl1 UTSW 5 72514289 missense possibly damaging 0.89
R7899:Nfxl1 UTSW 5 72524215 missense probably damaging 1.00
R8186:Nfxl1 UTSW 5 72559012 critical splice donor site probably null
R8765:Nfxl1 UTSW 5 72529100 missense probably benign
R8969:Nfxl1 UTSW 5 72559130 missense unknown
R9330:Nfxl1 UTSW 5 72524108 missense probably benign 0.00
R9385:Nfxl1 UTSW 5 72537407 missense probably benign 0.13
R9419:Nfxl1 UTSW 5 72559298 intron probably benign
R9496:Nfxl1 UTSW 5 72528159 missense possibly damaging 0.81
Z1176:Nfxl1 UTSW 5 72538150 missense probably null 0.89
Predicted Primers PCR Primer
(F):5'- AATAGGGTCTTGAGCTTGACTC -3'
(R):5'- TTCAGGATTAGTTGGCACAGTG -3'

Sequencing Primer
(F):5'- GAGCTTGACTCAACAGAAAAGC -3'
(R):5'- GTGTGTTGCATTCTGTAAAAATAACC -3'
Posted On 2021-01-18