Mutagenetix > Incidental Mutation

Incidental Mutation 'R8722:Pde10a'

662189

Institutional Source

Beutler Lab

Gene Symbol

Pde10a

Ensembl Gene

ENSMUSG00000023868

Gene Name

phosphodiesterase 10A

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8722 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

8525372-8986648 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 8944940 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Tyrosine at position 250 (C250Y)

Ref Sequence

ENSEMBL: ENSMUSP00000086485 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000024647] [ENSMUST00000089085] [ENSMUST00000115708] [ENSMUST00000115715] [ENSMUST00000115717] [ENSMUST00000115720] [ENSMUST00000115724] [ENSMUST00000149440] [ENSMUST00000231430]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000024647
AA Change: C170Y

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000024647
Gene: ENSMUSG00000023868
AA Change: C170Y

Domain	Start	End	E-Value	Type
GAF	21	174	1.44e-3	SMART
GAF	196	352	6.56e-29	SMART
HDc	442	608	9.04e-7	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000089085
AA Change: C250Y

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)

SMART Domains

Protein: ENSMUSP00000086485
Gene: ENSMUSG00000023868
AA Change: C250Y

Domain	Start	End	E-Value	Type
GAF	101	254	1.44e-3	SMART
GAF	276	432	6.56e-29	SMART
HDc	522	688	9.04e-7	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000115708

SMART Domains

Protein: ENSMUSP00000111373
Gene: ENSMUSG00000023868

Domain	Start	End	E-Value	Type
GAF	3	148	5.22e-23	SMART
HDc	238	404	9.04e-7	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000115715
AA Change: C170Y

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000111380
Gene: ENSMUSG00000023868
AA Change: C170Y

Domain	Start	End	E-Value	Type
GAF	21	174	1.44e-3	SMART
GAF	196	352	6.56e-29	SMART
HDc	442	608	9.04e-7	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000115717

Predicted Effect

probably benign
Transcript: ENSMUST00000115720
AA Change: C233Y

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)

SMART Domains

Protein: ENSMUSP00000111385
Gene: ENSMUSG00000023868
AA Change: C233Y

Domain	Start	End	E-Value	Type
GAF	84	237	1.44e-3	SMART
GAF	259	415	6.56e-29	SMART
HDc	505	671	9.04e-7	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000115724
AA Change: C304Y

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000111389
Gene: ENSMUSG00000023868
AA Change: C304Y

Domain	Start	End	E-Value	Type
GAF	95	248	1.44e-3	SMART
GAF	270	426	6.56e-29	SMART
HDc	516	682	9.04e-7	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000149440
AA Change: C181Y

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000123216
Gene: ENSMUSG00000023868
AA Change: C181Y

Domain	Start	End	E-Value	Type
GAF	32	185	1.44e-3	SMART
GAF	207	363	6.56e-29	SMART
HDc	453	619	9.04e-7	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000231430
AA Change: C532Y

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.2%
20x: 96.8%

Validation Efficiency

100% (54/54)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the cyclic nucleotide phosphodiesterase family. It plays a role in signal transduction by regulating the intracellular concentration of cyclic nucleotides. This protein can hydrolyze both cAMP and cGMP to the corresponding nucleoside 5' monophosphate, but has higher affinity for cAMP, and is more efficient with cAMP as substrate. Alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Homozygous mutation of this gene results in decreased exploratory behavior, hypoactivity, and a delay in the acquisition of conditioned avoidance behavior. A hypomorphic allele results in increased social behavior. Mice homozygous for a knock-out allele exhibit resistance to diet-induced obesity. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931422A03Rik	A	G	2: 103,992,756	C61R	probably benign	Het
4933427D14Rik	A	G	11: 72,189,596	F415L	probably benign	Het
Abcc2	G	A	19: 43,836,613	G1446D	possibly damaging	Het
Acaca	A	T	11: 84,338,457	E1703D	possibly damaging	Het
Acap3	T	C	4: 155,905,958	*834Q	probably null	Het
Adam22	A	G	5: 8,116,554	S726P	probably benign	Het
Adamtsl3	T	C	7: 82,595,537		probably null	Het
Adgrg6	T	A	10: 14,420,444	I1071F	probably benign	Het
Agxt2	A	T	15: 10,373,739	D77V	probably benign	Het
Ahnak	C	A	19: 9,013,346	S3998*	probably null	Het
Asns	T	A	6: 7,676,085	I462F	probably damaging	Het
Barx2	G	C	9: 31,912,984	C36W	probably damaging	Het
Bnc2	A	G	4: 84,293,646	V162A	possibly damaging	Het
Bptf	A	G	11: 107,131,469	S152P	unknown	Het
Brpf3	T	C	17: 28,810,536	L490P	probably benign	Het
Carmil1	T	C	13: 24,036,585	D1052G	probably benign	Het
Cdk17	A	G	10: 93,228,703	H311R	probably damaging	Het
Cenpj	G	A	14: 56,535,518	R1022C	probably damaging	Het
Cog5	A	G	12: 31,919,704	D741G	possibly damaging	Het
Csmd2	T	A	4: 128,551,950		probably benign	Het
Cyr61	T	A	3: 145,648,829	N109I	probably damaging	Het
Dnah17	G	A	11: 118,070,457	Q2568*	probably null	Het
Dspp	A	G	5: 104,178,567	D932G	unknown	Het
Dtwd2	T	C	18: 49,700,318	T223A	probably damaging	Het
Fzd8	A	G	18: 9,213,686	N256S	possibly damaging	Het
Gm10800	AAGAAAACTGAAAATCAT	A	2: 98,667,034		probably benign	Het
Gm9936	T	C	5: 114,857,454	Y34C	unknown	Het
Gstcd	T	A	3: 133,072,061	K330*	probably null	Het
Igf2bp1	A	G	11: 95,970,780	V277A	possibly damaging	Het
Kidins220	G	A	12: 25,001,594	V332I	probably benign	Het
Kif24	T	C	4: 41,394,233	H1014R	probably benign	Het
Lrrc43	T	C	5: 123,508,079	Y639H	possibly damaging	Het
Med22	T	C	2: 26,910,301	T39A	probably benign	Het
Morn3	T	C	5: 123,041,114	Y91C	probably damaging	Het
Myo1a	T	C	10: 127,706,838	M115T	probably damaging	Het
Olfr1493-ps1	T	C	19: 13,726,669	M136T	possibly damaging	Het
Olfr392	T	A	11: 73,815,056	I9F	probably benign	Het
Olfr667	C	T	7: 104,916,501	R265H	probably benign	Het
Pdcl	T	C	2: 37,357,305	D24G	probably benign	Het
Pla2g10	A	T	16: 13,730,390	L8M	unknown	Het
Plch2	A	T	4: 154,985,403		probably benign	Het
Ppp1r42	T	C	1: 9,985,669	K198R	probably benign	Het
Prlh	G	T	1: 90,953,175	R23L	possibly damaging	Het
Ranbp2	C	A	10: 58,476,227	T923K	probably damaging	Het
Rps11	T	C	7: 45,123,192	N65S	probably benign	Het
Ryr3	T	C	2: 112,772,771	T2463A	probably benign	Het
Shank2	C	T	7: 144,175,748		probably benign	Het
Slc12a1	T	A	2: 125,160,598	V166E	probably damaging	Het
Slc6a9	C	T	4: 117,857,255	R97C	unknown	Het
Slpi	A	C	2: 164,356,055	M1R	probably null	Het
Syne2	T	A	12: 75,925,321	V994D	probably benign	Het
Tacc3	T	C	5: 33,668,209	Y435H	probably damaging	Het
Tpgs2	T	A	18: 25,141,622	Q132L	probably benign	Het
Usp13	T	A	3: 32,901,965	I462N	probably benign	Het
Zfp281	C	T	1: 136,625,596	A104V	probably benign	Het
Zfp40	A	G	17: 23,176,183	C477R	probably damaging	Het

Other mutations in Pde10a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01534:Pde10a	APN	17	8944970	missense	probably damaging	1.00
IGL01762:Pde10a	APN	17	8942918	missense	possibly damaging	0.74
IGL01814:Pde10a	APN	17	8929107	start codon destroyed	probably null	0.00
IGL02053:Pde10a	APN	17	8974769	missense	probably damaging	1.00
IGL02386:Pde10a	APN	17	8953804	missense	possibly damaging	0.93
IGL02573:Pde10a	APN	17	8961890	missense	probably benign	0.38
IGL02583:Pde10a	APN	17	8981630	missense	probably benign	0.23
IGL02649:Pde10a	APN	17	8953772	missense	probably damaging	1.00
IGL02992:Pde10a	APN	17	8949461	missense	probably damaging	0.97
IGL03109:Pde10a	APN	17	8929214	critical splice donor site	probably null
brautigam	UTSW	17	8964677	missense	possibly damaging	0.78
Bride	UTSW	17	8949430	missense	possibly damaging	0.60
buzzed	UTSW	17	8930537	missense	probably damaging	1.00
Gracile	UTSW	17	8961920	missense	possibly damaging	0.63
Nubile	UTSW	17	8967462	missense	probably damaging	1.00
thunderball	UTSW	17	8969589	missense	probably damaging	1.00
R0004:Pde10a	UTSW	17	8981576	missense	probably benign	0.00
R0015:Pde10a	UTSW	17	8977197	missense	probably damaging	1.00
R0015:Pde10a	UTSW	17	8977197	missense	probably damaging	1.00
R0650:Pde10a	UTSW	17	8942965	missense	probably damaging	1.00
R1173:Pde10a	UTSW	17	8920546	splice site	probably benign
R1386:Pde10a	UTSW	17	8953742	missense	probably damaging	1.00
R1458:Pde10a	UTSW	17	8964708	missense	probably damaging	0.98
R1598:Pde10a	UTSW	17	8929144	missense	probably damaging	1.00
R1661:Pde10a	UTSW	17	8898870	missense	probably damaging	1.00
R1665:Pde10a	UTSW	17	8898870	missense	probably damaging	1.00
R1883:Pde10a	UTSW	17	8978944	missense	possibly damaging	0.86
R1960:Pde10a	UTSW	17	8942918	missense	possibly damaging	0.74
R2005:Pde10a	UTSW	17	8929091	critical splice acceptor site	probably null
R2071:Pde10a	UTSW	17	8961995	missense	probably benign	0.22
R2121:Pde10a	UTSW	17	8977215	missense	probably damaging	1.00
R2376:Pde10a	UTSW	17	8930537	missense	probably damaging	1.00
R3721:Pde10a	UTSW	17	8969589	missense	probably damaging	1.00
R3872:Pde10a	UTSW	17	8757091	missense	possibly damaging	0.92
R4627:Pde10a	UTSW	17	8981652	missense	probably damaging	1.00
R4652:Pde10a	UTSW	17	8757053	missense	possibly damaging	0.82
R5107:Pde10a	UTSW	17	8944970	missense	probably damaging	1.00
R5184:Pde10a	UTSW	17	8977155	missense	probably damaging	1.00
R5354:Pde10a	UTSW	17	8961980	missense	probably damaging	0.97
R5735:Pde10a	UTSW	17	8941192	missense	probably damaging	0.99
R5878:Pde10a	UTSW	17	8949372	missense	possibly damaging	0.85
R5921:Pde10a	UTSW	17	8930537	missense	probably damaging	1.00
R6027:Pde10a	UTSW	17	8964677	missense	possibly damaging	0.78
R6145:Pde10a	UTSW	17	8929117	missense	probably damaging	1.00
R6279:Pde10a	UTSW	17	8978957	missense	probably damaging	0.99
R6409:Pde10a	UTSW	17	8949438	missense	probably damaging	1.00
R6870:Pde10a	UTSW	17	8967524	missense	possibly damaging	0.56
R6947:Pde10a	UTSW	17	8969592	missense	probably damaging	1.00
R7072:Pde10a	UTSW	17	8943026	missense	probably benign	0.40
R7084:Pde10a	UTSW	17	8941162	missense	probably benign	0.25
R7294:Pde10a	UTSW	17	8757021	missense	probably benign
R7339:Pde10a	UTSW	17	8757028	missense	probably benign	0.01
R7347:Pde10a	UTSW	17	8967462	missense	probably damaging	1.00
R7373:Pde10a	UTSW	17	8942992	missense	probably benign	0.00
R7481:Pde10a	UTSW	17	8949430	missense	possibly damaging	0.60
R7833:Pde10a	UTSW	17	8961920	missense	possibly damaging	0.63
R7923:Pde10a	UTSW	17	8929132	missense	probably benign	0.40
R8053:Pde10a	UTSW	17	8974772	missense	probably benign	0.12
R8137:Pde10a	UTSW	17	8974815	missense	possibly damaging	0.90
R8918:Pde10a	UTSW	17	8941231	missense	possibly damaging	0.65
R8973:Pde10a	UTSW	17	8924239	missense	probably benign
R9113:Pde10a	UTSW	17	8978950	missense	probably benign
R9163:Pde10a	UTSW	17	8962959	missense	possibly damaging	0.89
R9275:Pde10a	UTSW	17	8981656	makesense	probably null
R9563:Pde10a	UTSW	17	8801878	missense	unknown
R9641:Pde10a	UTSW	17	8978984	missense
R9660:Pde10a	UTSW	17	8951538	missense	probably damaging	0.99
R9670:Pde10a	UTSW	17	8801440	missense	unknown

Predicted Primers

PCR Primer
(F):5'- TTGTGCCGTTCTCCAGTGAG -3'
(R):5'- CCTTTAACGTACAAGCTGGC -3'

Sequencing Primer
(F):5'- GCCGTTCTCCAGTGAGATAAG -3'
(R):5'- GCAATTCTATAATCCGCATGCG -3'

Posted On

2021-03-08