Incidental Mutation 'R8722:Pde10a'
ID662189
Institutional Source Beutler Lab
Gene Symbol Pde10a
Ensembl Gene ENSMUSG00000023868
Gene Namephosphodiesterase 10A
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8722 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location8525372-8986648 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 8944940 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 250 (C250Y)
Ref Sequence ENSEMBL: ENSMUSP00000086485 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024647] [ENSMUST00000089085] [ENSMUST00000115708] [ENSMUST00000115715] [ENSMUST00000115717] [ENSMUST00000115720] [ENSMUST00000115724] [ENSMUST00000149440] [ENSMUST00000231430]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000024647
AA Change: C170Y

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000024647
Gene: ENSMUSG00000023868
AA Change: C170Y

DomainStartEndE-ValueType
GAF 21 174 1.44e-3 SMART
GAF 196 352 6.56e-29 SMART
HDc 442 608 9.04e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000089085
AA Change: C250Y

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000086485
Gene: ENSMUSG00000023868
AA Change: C250Y

DomainStartEndE-ValueType
GAF 101 254 1.44e-3 SMART
GAF 276 432 6.56e-29 SMART
HDc 522 688 9.04e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115708
SMART Domains Protein: ENSMUSP00000111373
Gene: ENSMUSG00000023868

DomainStartEndE-ValueType
GAF 3 148 5.22e-23 SMART
HDc 238 404 9.04e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000115715
AA Change: C170Y

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000111380
Gene: ENSMUSG00000023868
AA Change: C170Y

DomainStartEndE-ValueType
GAF 21 174 1.44e-3 SMART
GAF 196 352 6.56e-29 SMART
HDc 442 608 9.04e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115717
Predicted Effect probably benign
Transcript: ENSMUST00000115720
AA Change: C233Y

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000111385
Gene: ENSMUSG00000023868
AA Change: C233Y

DomainStartEndE-ValueType
GAF 84 237 1.44e-3 SMART
GAF 259 415 6.56e-29 SMART
HDc 505 671 9.04e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000115724
AA Change: C304Y

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000111389
Gene: ENSMUSG00000023868
AA Change: C304Y

DomainStartEndE-ValueType
GAF 95 248 1.44e-3 SMART
GAF 270 426 6.56e-29 SMART
HDc 516 682 9.04e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000149440
AA Change: C181Y

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000123216
Gene: ENSMUSG00000023868
AA Change: C181Y

DomainStartEndE-ValueType
GAF 32 185 1.44e-3 SMART
GAF 207 363 6.56e-29 SMART
HDc 453 619 9.04e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000231430
AA Change: C532Y

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 96.8%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the cyclic nucleotide phosphodiesterase family. It plays a role in signal transduction by regulating the intracellular concentration of cyclic nucleotides. This protein can hydrolyze both cAMP and cGMP to the corresponding nucleoside 5' monophosphate, but has higher affinity for cAMP, and is more efficient with cAMP as substrate. Alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Homozygous mutation of this gene results in decreased exploratory behavior, hypoactivity, and a delay in the acquisition of conditioned avoidance behavior. A hypomorphic allele results in increased social behavior. Mice homozygous for a knock-out allele exhibit resistance to diet-induced obesity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931422A03Rik A G 2: 103,992,756 C61R probably benign Het
4933427D14Rik A G 11: 72,189,596 F415L probably benign Het
Abcc2 G A 19: 43,836,613 G1446D possibly damaging Het
Acaca A T 11: 84,338,457 E1703D possibly damaging Het
Acap3 T C 4: 155,905,958 *834Q probably null Het
Adam22 A G 5: 8,116,554 S726P probably benign Het
Adamtsl3 T C 7: 82,595,537 probably null Het
Adgrg6 T A 10: 14,420,444 I1071F probably benign Het
Agxt2 A T 15: 10,373,739 D77V probably benign Het
Ahnak C A 19: 9,013,346 S3998* probably null Het
Asns T A 6: 7,676,085 I462F probably damaging Het
Barx2 G C 9: 31,912,984 C36W probably damaging Het
Bnc2 A G 4: 84,293,646 V162A possibly damaging Het
Bptf A G 11: 107,131,469 S152P unknown Het
Brpf3 T C 17: 28,810,536 L490P probably benign Het
Carmil1 T C 13: 24,036,585 D1052G probably benign Het
Cdk17 A G 10: 93,228,703 H311R probably damaging Het
Cenpj G A 14: 56,535,518 R1022C probably damaging Het
Cog5 A G 12: 31,919,704 D741G possibly damaging Het
Csmd2 T A 4: 128,551,950 probably benign Het
Cyr61 T A 3: 145,648,829 N109I probably damaging Het
Dnah17 G A 11: 118,070,457 Q2568* probably null Het
Dspp A G 5: 104,178,567 D932G unknown Het
Dtwd2 T C 18: 49,700,318 T223A probably damaging Het
Fzd8 A G 18: 9,213,686 N256S possibly damaging Het
Gm10800 AAGAAAACTGAAAATCAT A 2: 98,667,034 probably benign Het
Gm9936 T C 5: 114,857,454 Y34C unknown Het
Gstcd T A 3: 133,072,061 K330* probably null Het
Igf2bp1 A G 11: 95,970,780 V277A possibly damaging Het
Kidins220 G A 12: 25,001,594 V332I probably benign Het
Kif24 T C 4: 41,394,233 H1014R probably benign Het
Lrrc43 T C 5: 123,508,079 Y639H possibly damaging Het
Med22 T C 2: 26,910,301 T39A probably benign Het
Morn3 T C 5: 123,041,114 Y91C probably damaging Het
Myo1a T C 10: 127,706,838 M115T probably damaging Het
Olfr1493-ps1 T C 19: 13,726,669 M136T possibly damaging Het
Olfr392 T A 11: 73,815,056 I9F probably benign Het
Olfr667 C T 7: 104,916,501 R265H probably benign Het
Pdcl T C 2: 37,357,305 D24G probably benign Het
Pla2g10 A T 16: 13,730,390 L8M unknown Het
Plch2 A T 4: 154,985,403 probably benign Het
Ppp1r42 T C 1: 9,985,669 K198R probably benign Het
Prlh G T 1: 90,953,175 R23L possibly damaging Het
Ranbp2 C A 10: 58,476,227 T923K probably damaging Het
Rps11 T C 7: 45,123,192 N65S probably benign Het
Ryr3 T C 2: 112,772,771 T2463A probably benign Het
Shank2 C T 7: 144,175,748 probably benign Het
Slc12a1 T A 2: 125,160,598 V166E probably damaging Het
Slc6a9 C T 4: 117,857,255 R97C unknown Het
Slpi A C 2: 164,356,055 M1R probably null Het
Syne2 T A 12: 75,925,321 V994D probably benign Het
Tacc3 T C 5: 33,668,209 Y435H probably damaging Het
Tpgs2 T A 18: 25,141,622 Q132L probably benign Het
Usp13 T A 3: 32,901,965 I462N probably benign Het
Zfp281 C T 1: 136,625,596 A104V probably benign Het
Zfp40 A G 17: 23,176,183 C477R probably damaging Het
Other mutations in Pde10a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01534:Pde10a APN 17 8944970 missense probably damaging 1.00
IGL01762:Pde10a APN 17 8942918 missense possibly damaging 0.74
IGL01814:Pde10a APN 17 8929107 start codon destroyed probably null 0.00
IGL02053:Pde10a APN 17 8974769 missense probably damaging 1.00
IGL02386:Pde10a APN 17 8953804 missense possibly damaging 0.93
IGL02573:Pde10a APN 17 8961890 missense probably benign 0.38
IGL02583:Pde10a APN 17 8981630 missense probably benign 0.23
IGL02649:Pde10a APN 17 8953772 missense probably damaging 1.00
IGL02992:Pde10a APN 17 8949461 missense probably damaging 0.97
IGL03109:Pde10a APN 17 8929214 critical splice donor site probably null
brautigam UTSW 17 8964677 missense possibly damaging 0.78
Bride UTSW 17 8949430 missense possibly damaging 0.60
buzzed UTSW 17 8930537 missense probably damaging 1.00
Gracile UTSW 17 8961920 missense possibly damaging 0.63
Nubile UTSW 17 8967462 missense probably damaging 1.00
thunderball UTSW 17 8969589 missense probably damaging 1.00
R0004:Pde10a UTSW 17 8981576 missense probably benign 0.00
R0015:Pde10a UTSW 17 8977197 missense probably damaging 1.00
R0015:Pde10a UTSW 17 8977197 missense probably damaging 1.00
R0650:Pde10a UTSW 17 8942965 missense probably damaging 1.00
R1173:Pde10a UTSW 17 8920546 splice site probably benign
R1386:Pde10a UTSW 17 8953742 missense probably damaging 1.00
R1458:Pde10a UTSW 17 8964708 missense probably damaging 0.98
R1598:Pde10a UTSW 17 8929144 missense probably damaging 1.00
R1661:Pde10a UTSW 17 8898870 missense probably damaging 1.00
R1665:Pde10a UTSW 17 8898870 missense probably damaging 1.00
R1883:Pde10a UTSW 17 8978944 missense possibly damaging 0.86
R1960:Pde10a UTSW 17 8942918 missense possibly damaging 0.74
R2005:Pde10a UTSW 17 8929091 critical splice acceptor site probably null
R2071:Pde10a UTSW 17 8961995 missense probably benign 0.22
R2121:Pde10a UTSW 17 8977215 missense probably damaging 1.00
R2376:Pde10a UTSW 17 8930537 missense probably damaging 1.00
R3721:Pde10a UTSW 17 8969589 missense probably damaging 1.00
R3872:Pde10a UTSW 17 8757091 missense possibly damaging 0.92
R4627:Pde10a UTSW 17 8981652 missense probably damaging 1.00
R4652:Pde10a UTSW 17 8757053 missense possibly damaging 0.82
R5107:Pde10a UTSW 17 8944970 missense probably damaging 1.00
R5184:Pde10a UTSW 17 8977155 missense probably damaging 1.00
R5354:Pde10a UTSW 17 8961980 missense probably damaging 0.97
R5735:Pde10a UTSW 17 8941192 missense probably damaging 0.99
R5878:Pde10a UTSW 17 8949372 missense possibly damaging 0.85
R5921:Pde10a UTSW 17 8930537 missense probably damaging 1.00
R6027:Pde10a UTSW 17 8964677 missense possibly damaging 0.78
R6145:Pde10a UTSW 17 8929117 missense probably damaging 1.00
R6279:Pde10a UTSW 17 8978957 missense probably damaging 0.99
R6409:Pde10a UTSW 17 8949438 missense probably damaging 1.00
R6870:Pde10a UTSW 17 8967524 missense possibly damaging 0.56
R6947:Pde10a UTSW 17 8969592 missense probably damaging 1.00
R7072:Pde10a UTSW 17 8943026 missense probably benign 0.40
R7084:Pde10a UTSW 17 8941162 missense probably benign 0.25
R7294:Pde10a UTSW 17 8757021 missense probably benign
R7339:Pde10a UTSW 17 8757028 missense probably benign 0.01
R7347:Pde10a UTSW 17 8967462 missense probably damaging 1.00
R7373:Pde10a UTSW 17 8942992 missense probably benign 0.00
R7481:Pde10a UTSW 17 8949430 missense possibly damaging 0.60
R7833:Pde10a UTSW 17 8961920 missense possibly damaging 0.63
R7923:Pde10a UTSW 17 8929132 missense probably benign 0.40
R8053:Pde10a UTSW 17 8974772 missense probably benign 0.12
R8137:Pde10a UTSW 17 8974815 missense possibly damaging 0.90
R8918:Pde10a UTSW 17 8941231 missense possibly damaging 0.65
R8973:Pde10a UTSW 17 8924239 missense probably benign
R9113:Pde10a UTSW 17 8978950 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTGTGCCGTTCTCCAGTGAG -3'
(R):5'- CCTTTAACGTACAAGCTGGC -3'

Sequencing Primer
(F):5'- GCCGTTCTCCAGTGAGATAAG -3'
(R):5'- GCAATTCTATAATCCGCATGCG -3'
Posted On2021-03-08