Incidental Mutation 'R8726:Fmn2'
ID662401
Institutional Source Beutler Lab
Gene Symbol Fmn2
Ensembl Gene ENSMUSG00000028354
Gene Nameformin 2
Synonyms
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.810) question?
Stock #R8726 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location174501825-174822729 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 174609838 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Asparagine at position 1125 (T1125N)
Ref Sequence ENSEMBL: ENSMUSP00000030039 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030039]
Predicted Effect possibly damaging
Transcript: ENSMUST00000030039
AA Change: T1125N

PolyPhen 2 Score 0.863 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000030039
Gene: ENSMUSG00000028354
AA Change: T1125N

DomainStartEndE-ValueType
low complexity region 35 69 N/A INTRINSIC
low complexity region 196 212 N/A INTRINSIC
low complexity region 304 334 N/A INTRINSIC
Blast:FH2 353 577 2e-97 BLAST
low complexity region 604 616 N/A INTRINSIC
coiled coil region 645 681 N/A INTRINSIC
Blast:FH2 710 788 2e-14 BLAST
low complexity region 796 831 N/A INTRINSIC
Pfam:Drf_FH1 942 1048 3.1e-16 PFAM
low complexity region 1117 1131 N/A INTRINSIC
FH2 1139 1543 1.29e-85 SMART
PDB:2YLE|B 1550 1578 4e-11 PDB
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the formin homology protein family. The encoded protein is thought to have essential roles in organization of the actin cytoskeleton and in cell polarity. Mutations in this gene have been associated with mental retardation autosomal recessive 47 (MRT47). Alternatively spliced transcript variants have been identified. [provided by RefSeq, Mar 2015]
PHENOTYPE: Female mice homozygous for a knock-out allele display polyploid embryo formation, recurrent pregnancy loss, hypofertility, and inadequate nursing behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810408A11Rik A G 11: 69,898,381 S331P possibly damaging Het
4930433I11Rik A G 7: 40,994,802 M632V probably benign Het
9930111J21Rik2 A C 11: 49,019,680 V642G probably damaging Het
Acsbg1 T C 9: 54,618,178 E363G probably damaging Het
Ank3 T A 10: 69,987,254 H584Q Het
Ankrd11 A T 8: 122,894,026 L1029Q possibly damaging Het
Anpep C T 7: 79,840,893 V292I probably benign Het
Atmin G A 8: 116,954,786 D175N possibly damaging Het
B4galt6 T C 18: 20,688,393 I359M possibly damaging Het
Bicd2 A G 13: 49,379,429 D497G probably damaging Het
Camkk2 G T 5: 122,743,939 D418E probably benign Het
Cntn3 A T 6: 102,169,053 Y942* probably null Het
Col8a1 C T 16: 57,628,775 R124H probably damaging Het
Coro7 T C 16: 4,668,755 T185A possibly damaging Het
Creb3 C T 4: 43,566,747 P364S probably benign Het
Csf1r A T 18: 61,117,656 T480S probably benign Het
Csnk1g1 T A 9: 66,002,271 H223Q probably damaging Het
Ctns C T 11: 73,187,787 V171M probably benign Het
Dhx15 A T 5: 52,154,226 N637K probably benign Het
Eif4g1 T C 16: 20,675,482 Y103H probably damaging Het
Eif4g2 C T 7: 111,077,422 R295H probably damaging Het
Fam126b T C 1: 58,546,126 T171A possibly damaging Het
Fat1 C T 8: 45,024,169 P2084L probably benign Het
Fat4 A G 3: 39,010,498 R4868G probably damaging Het
Fbxo31 A T 8: 121,555,275 Y295* probably null Het
Foxi2 C A 7: 135,410,404 P7Q probably damaging Het
Hmx1 C T 5: 35,391,756 P131L probably damaging Het
Hrh2 T C 13: 54,214,152 L49P probably damaging Het
Igkv6-14 A G 6: 70,435,141 V53A possibly damaging Het
Kcnb2 C A 1: 15,710,652 Q583K probably benign Het
Kcns3 A G 12: 11,091,691 S336P probably damaging Het
Kremen2 G T 17: 23,742,746 F262L probably damaging Het
Krtap9-1 T A 11: 99,873,751 C104* probably null Het
Ky A G 9: 102,527,903 Y199C probably damaging Het
L1td1 T G 4: 98,733,978 L259R probably damaging Het
Lrba A G 3: 86,353,755 T1473A probably benign Het
Lrp6 A T 6: 134,507,661 L333* probably null Het
Lrrc23 T C 6: 124,776,080 N201S probably benign Het
Map4k4 C A 1: 40,003,982 P666T possibly damaging Het
Matn1 T A 4: 130,952,203 D389E probably damaging Het
Mdc1 G T 17: 35,847,583 G285V probably benign Het
Mettl17 T C 14: 51,890,730 probably null Het
Neurod1 A T 2: 79,454,086 F318I possibly damaging Het
Nfya T C 17: 48,392,417 T213A probably damaging Het
Nmrk1 C T 19: 18,639,538 T17M probably damaging Het
Ntrk1 A C 3: 87,786,089 D245E probably benign Het
Nup160 C A 2: 90,733,201 H1370Q possibly damaging Het
Olfr1151 T C 2: 87,857,817 V214A probably benign Het
Olfr745 A C 14: 50,643,246 K316Q probably benign Het
Olfr986 T A 9: 40,187,367 V84E probably damaging Het
Parp4 G A 14: 56,629,099 R1040H probably benign Het
Pdia4 C A 6: 47,808,266 E56* probably null Het
Pdia5 A G 16: 35,449,414 F175S probably damaging Het
Piezo2 C T 18: 63,109,885 S621N probably benign Het
Pigw T C 11: 84,877,817 T229A possibly damaging Het
Rasa3 T C 8: 13,576,381 Y734C probably benign Het
Rims1 T C 1: 22,594,100 D178G possibly damaging Het
Rps7 A G 12: 28,631,715 I139T probably benign Het
Sall3 T C 18: 80,986,493 D15G possibly damaging Het
Scn1a A T 2: 66,303,639 V137D probably benign Het
Slc23a3 G A 1: 75,129,529 P349S probably benign Het
Son CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC 16: 91,656,691 probably benign Het
Stard13 A T 5: 151,063,142 M301K probably benign Het
Suclg2 A G 6: 95,655,508 F60S probably damaging Het
Tecpr2 T A 12: 110,938,234 F887L possibly damaging Het
Tekt4 G T 17: 25,472,059 W113L probably damaging Het
Tep1 G A 14: 50,847,623 S901F probably damaging Het
Tex11 C T X: 101,015,585 V190I possibly damaging Het
Thbs1 T A 2: 118,119,476 probably null Het
Tm9sf4 T A 2: 153,198,375 V425D probably damaging Het
Tpo A G 12: 30,055,138 L911P possibly damaging Het
Ttn T C 2: 76,898,957 Q5332R unknown Het
Wdr59 A T 8: 111,496,834 D169E Het
Zfp799 C A 17: 32,820,192 G367C probably damaging Het
Other mutations in Fmn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01067:Fmn2 APN 1 174503319 missense unknown
IGL01085:Fmn2 APN 1 174695654 missense probably damaging 1.00
IGL01784:Fmn2 APN 1 174502428 missense unknown
IGL02095:Fmn2 APN 1 174502601 missense unknown
IGL02330:Fmn2 APN 1 174609945 missense probably benign 0.38
IGL02552:Fmn2 APN 1 174695720 missense probably damaging 1.00
IGL02835:Fmn2 UTSW 1 174582059 missense unknown
PIT4498001:Fmn2 UTSW 1 174612604 missense probably damaging 1.00
PIT4677001:Fmn2 UTSW 1 174647133 missense probably damaging 1.00
R0025:Fmn2 UTSW 1 174791314 missense probably damaging 1.00
R0062:Fmn2 UTSW 1 174608449 unclassified probably benign
R0062:Fmn2 UTSW 1 174608449 unclassified probably benign
R0306:Fmn2 UTSW 1 174609484 unclassified probably benign
R0325:Fmn2 UTSW 1 174609954 critical splice donor site probably null
R0403:Fmn2 UTSW 1 174694278 missense probably damaging 1.00
R0491:Fmn2 UTSW 1 174581959 missense unknown
R0898:Fmn2 UTSW 1 174503460 missense unknown
R1202:Fmn2 UTSW 1 174612535 nonsense probably null
R1719:Fmn2 UTSW 1 174608458 unclassified probably benign
R1763:Fmn2 UTSW 1 174502266 missense unknown
R1771:Fmn2 UTSW 1 174608776 unclassified probably benign
R1777:Fmn2 UTSW 1 174581922 missense unknown
R1831:Fmn2 UTSW 1 174609945 missense probably benign 0.38
R2259:Fmn2 UTSW 1 174502932 missense unknown
R2960:Fmn2 UTSW 1 174609819 missense probably damaging 1.00
R3545:Fmn2 UTSW 1 174502626 missense unknown
R3840:Fmn2 UTSW 1 174582033 frame shift probably null
R4207:Fmn2 UTSW 1 174581955 missense unknown
R4679:Fmn2 UTSW 1 174503162 missense unknown
R4779:Fmn2 UTSW 1 174609895 missense probably damaging 1.00
R4887:Fmn2 UTSW 1 174581961 missense unknown
R4926:Fmn2 UTSW 1 174502415 missense unknown
R5007:Fmn2 UTSW 1 174744300 missense probably damaging 1.00
R5247:Fmn2 UTSW 1 174821228 missense probably benign 0.04
R5324:Fmn2 UTSW 1 174608880 unclassified probably benign
R5353:Fmn2 UTSW 1 174503006 missense unknown
R5420:Fmn2 UTSW 1 174698778 nonsense probably null
R5607:Fmn2 UTSW 1 174609811 missense probably damaging 0.97
R5668:Fmn2 UTSW 1 174582037 missense unknown
R5982:Fmn2 UTSW 1 174502453 missense unknown
R6148:Fmn2 UTSW 1 174666663 missense probably damaging 1.00
R6324:Fmn2 UTSW 1 174612553 missense possibly damaging 0.87
R6466:Fmn2 UTSW 1 174609583 unclassified probably benign
R6647:Fmn2 UTSW 1 174593104 missense unknown
R6835:Fmn2 UTSW 1 174699669 missense probably damaging 1.00
R7231:Fmn2 UTSW 1 174609203 unclassified probably benign
R7340:Fmn2 UTSW 1 174609203 unclassified probably benign
R7378:Fmn2 UTSW 1 174609203 unclassified probably benign
R7457:Fmn2 UTSW 1 174503737 splice site probably null
R7474:Fmn2 UTSW 1 174609203 unclassified probably benign
R7564:Fmn2 UTSW 1 174609574 missense unknown
R7582:Fmn2 UTSW 1 174698790 missense probably damaging 1.00
R7748:Fmn2 UTSW 1 174666649 missense probably damaging 1.00
R7832:Fmn2 UTSW 1 174609203 unclassified probably benign
R8035:Fmn2 UTSW 1 174719871 missense probably damaging 1.00
R8203:Fmn2 UTSW 1 174609203 unclassified probably benign
R8343:Fmn2 UTSW 1 174609203 unclassified probably benign
R8371:Fmn2 UTSW 1 174609607 missense unknown
R8377:Fmn2 UTSW 1 174608445 nonsense probably null
R8543:Fmn2 UTSW 1 174609203 unclassified probably benign
R8724:Fmn2 UTSW 1 174609203 unclassified probably benign
R8891:Fmn2 UTSW 1 174609203 unclassified probably benign
RF010:Fmn2 UTSW 1 174582015 missense unknown
Z1176:Fmn2 UTSW 1 174608394 missense unknown
Predicted Primers PCR Primer
(F):5'- CACTTCCAGGAGTGGGAATACC -3'
(R):5'- GTAAGTGTCCCCTGGTGGAAAG -3'

Sequencing Primer
(F):5'- TGGATCAGGCATACCCCCTC -3'
(R):5'- TGTCCCCTGGTGGAAAGAAACC -3'
Posted On2021-03-08