Incidental Mutation 'R8845:Brca2'
ID 674650
Institutional Source Beutler Lab
Gene Symbol Brca2
Ensembl Gene ENSMUSG00000041147
Gene Name breast cancer 2, early onset
Synonyms Fancd1, RAB163
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8845 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 150522630-150570329 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 150543382 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 2204 (F2204L)
Ref Sequence ENSEMBL: ENSMUSP00000144150 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044620] [ENSMUST00000202003] [ENSMUST00000202313]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000044620
AA Change: F2204L

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000038576
Gene: ENSMUSG00000041147
AA Change: F2204L

DomainStartEndE-ValueType
low complexity region 36 51 N/A INTRINSIC
low complexity region 100 123 N/A INTRINSIC
low complexity region 187 199 N/A INTRINSIC
low complexity region 746 761 N/A INTRINSIC
low complexity region 904 917 N/A INTRINSIC
Pfam:BRCA2 982 1014 2.6e-13 PFAM
Pfam:BRCA2 1193 1225 3.9e-16 PFAM
low complexity region 1239 1252 N/A INTRINSIC
Pfam:BRCA2 1395 1425 1.4e-13 PFAM
Pfam:BRCA2 1492 1524 1.8e-13 PFAM
Pfam:BRCA2 1624 1655 8.4e-12 PFAM
Pfam:BRCA2 1925 1957 8e-15 PFAM
Pfam:BRCA2 2005 2037 1.7e-11 PFAM
Pfam:BRCA-2_helical 2402 2588 1.3e-94 PFAM
Pfam:BRCA-2_OB1 2591 2717 5.3e-44 PFAM
Tower 2752 2793 2.37e-18 SMART
Pfam:BRCA-2_OB3 2971 3104 1.5e-49 PFAM
low complexity region 3197 3208 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000202003
SMART Domains Protein: ENSMUSP00000144676
Gene: ENSMUSG00000041147

DomainStartEndE-ValueType
low complexity region 36 51 N/A INTRINSIC
low complexity region 100 123 N/A INTRINSIC
low complexity region 187 199 N/A INTRINSIC
low complexity region 746 761 N/A INTRINSIC
low complexity region 904 917 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000202313
AA Change: F2204L

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000144150
Gene: ENSMUSG00000041147
AA Change: F2204L

DomainStartEndE-ValueType
low complexity region 36 51 N/A INTRINSIC
low complexity region 100 123 N/A INTRINSIC
low complexity region 187 199 N/A INTRINSIC
low complexity region 746 761 N/A INTRINSIC
low complexity region 904 917 N/A INTRINSIC
Pfam:BRCA2 982 1014 2.6e-13 PFAM
Pfam:BRCA2 1193 1225 3.9e-16 PFAM
low complexity region 1239 1252 N/A INTRINSIC
Pfam:BRCA2 1395 1425 1.4e-13 PFAM
Pfam:BRCA2 1492 1524 1.8e-13 PFAM
Pfam:BRCA2 1624 1655 8.4e-12 PFAM
Pfam:BRCA2 1925 1957 8e-15 PFAM
Pfam:BRCA2 2005 2037 1.7e-11 PFAM
Pfam:BRCA-2_helical 2402 2588 1.3e-94 PFAM
Pfam:BRCA-2_OB1 2591 2717 5.3e-44 PFAM
Tower 2752 2793 2.37e-18 SMART
Pfam:BRCA-2_OB3 2971 3104 1.5e-49 PFAM
low complexity region 3197 3208 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Inherited mutations in BRCA1 and this gene, BRCA2, confer increased lifetime risk of developing breast or ovarian cancer. Both BRCA1 and BRCA2 are involved in maintenance of genome stability, specifically the homologous recombination pathway for double-strand DNA repair. The BRCA2 protein contains several copies of a 70 aa motif called the BRC motif, and these motifs mediate binding to the RAD51 recombinase which functions in DNA repair. BRCA2 is considered a tumor suppressor gene, as tumors with BRCA2 mutations generally exhibit loss of heterozygosity (LOH) of the wild-type allele. [provided by RefSeq, Dec 2008]
PHENOTYPE: Homozygous null mutants are embryonic lethal with abnormalities including growth retardation, neural tube defects, and mesoderm abnormalities; conditional mutations cause genetic instability and enhanced tumor formation; mutants with truncated BRCA2 protein survive, are small, infertile, show improper tissue differentiation and develop lymphomas and carcinomas. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930017K11Rik A T 17: 25,946,849 V488E probably benign Het
Abca14 C T 7: 120,247,205 P627S probably benign Het
Abca4 G A 3: 122,137,002 V1383M probably damaging Het
Acer3 A G 7: 98,261,625 S77P probably damaging Het
Adgrv1 G T 13: 81,481,359 T3640N possibly damaging Het
Agmo T C 12: 37,244,365 L104P probably benign Het
Alox12 C A 11: 70,247,051 G421V probably damaging Het
Atad2 A G 15: 58,126,136 V182A probably damaging Het
Bnc2 C T 4: 84,276,101 A929T possibly damaging Het
Bola3 T C 6: 83,358,172 M83T probably damaging Het
Cachd1 T C 4: 100,953,146 V315A probably benign Het
Ccdc154 C A 17: 25,171,164 N547K probably damaging Het
Ccdc62 C A 5: 123,954,407 T485K probably benign Het
Cdc40 G A 10: 40,841,794 T371I possibly damaging Het
Cep112 T C 11: 108,570,367 F657L probably damaging Het
Cirbp A G 10: 80,170,097 D62G probably damaging Het
Cntf A C 19: 12,764,300 S65R probably benign Het
Cxxc4 CGGC CGGCGGGGGC 3: 134,240,151 probably benign Het
Cyfip1 G T 7: 55,930,086 G1229V probably benign Het
Cyp4a30b A C 4: 115,458,296 N238T probably benign Het
Dbx2 G A 15: 95,654,636 R43C probably benign Het
Fbxw13 G T 9: 109,194,765 F70L possibly damaging Het
Fhod3 A G 18: 25,132,919 T1555A probably damaging Het
Fnbp4 A G 2: 90,776,024 M763V probably benign Het
Gdf7 A G 12: 8,298,905 S131P unknown Het
Gm11639 A T 11: 105,008,961 I4350F possibly damaging Het
Gm9938 A T 19: 23,724,577 E93V unknown Het
Golim4 A T 3: 75,894,965 M340K probably damaging Het
Gphn A G 12: 78,492,179 S200G probably benign Het
Hpse T C 5: 100,711,382 D99G probably benign Het
Iqgap2 A T 13: 95,657,884 N1193K possibly damaging Het
Jag2 A T 12: 112,920,094 C256S probably damaging Het
Ldb3 T C 14: 34,536,677 Y657C probably damaging Het
Lmtk2 T A 5: 144,173,886 Y475N probably damaging Het
Mep1b A T 18: 21,097,322 K644* probably null Het
Muc4 A C 16: 32,756,515 T60P possibly damaging Het
Nckap5 G T 1: 125,981,686 Q1603K possibly damaging Het
Npy6r C T 18: 44,275,539 T9I probably benign Het
Nsd2 T C 5: 33,882,541 C846R probably damaging Het
Oard1 A C 17: 48,414,231 K64Q probably benign Het
Olfr1151 G T 2: 87,857,201 V9L probably benign Het
Olfr1195 T A 2: 88,683,391 I114F possibly damaging Het
Olfr603 A T 7: 103,383,150 V284D probably damaging Het
Olfr784 A G 10: 129,388,196 T188A probably damaging Het
Pkhd1l1 T G 15: 44,505,254 S823A probably benign Het
Pla2r1 A G 2: 60,428,709 S1112P possibly damaging Het
Plekho2 T C 9: 65,558,681 T142A probably damaging Het
Prrc2b T A 2: 32,212,093 M726K possibly damaging Het
Prrc2b A T 2: 32,216,150 K1514I possibly damaging Het
Rin1 A T 19: 5,054,919 D669V probably damaging Het
Setd1b C T 5: 123,144,247 A146V unknown Het
Sigmar1 G A 4: 41,741,234 R7W probably damaging Het
Slain1 C T 14: 103,688,311 T365I possibly damaging Het
Slc38a2 G A 15: 96,695,019 T186I probably benign Het
Tas2r130 A T 6: 131,630,679 V51E probably benign Het
Tgfb1i1 A T 7: 128,252,518 H332L possibly damaging Het
Trav7n-4 T C 14: 53,091,389 L15S probably damaging Het
Ttc28 T C 5: 111,224,175 V861A probably benign Het
Ttn T C 2: 76,776,036 E18143G probably damaging Het
Ttn A G 2: 76,802,314 I14132T probably damaging Het
Vmn1r203 C T 13: 22,524,550 S167L possibly damaging Het
Vmn2r108 A T 17: 20,471,099 H387Q probably benign Het
Vps33a A T 5: 123,571,475 probably null Het
Vps50 G A 6: 3,504,926 V31I probably benign Het
Wdcp A G 12: 4,851,439 T432A probably benign Het
Wdr36 T A 18: 32,861,045 Y645* probably null Het
Other mutations in Brca2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Brca2 APN 5 150539898 missense probably benign 0.18
IGL00392:Brca2 APN 5 150541240 missense probably benign 0.02
IGL00557:Brca2 APN 5 150560538 missense probably benign
IGL00798:Brca2 APN 5 150539463 missense probably benign 0.30
IGL00933:Brca2 APN 5 150542404 missense probably benign 0.04
IGL00964:Brca2 APN 5 150532310 missense probably damaging 1.00
IGL01152:Brca2 APN 5 150542390 missense probably damaging 0.99
IGL01577:Brca2 APN 5 150541620 nonsense probably null
IGL01585:Brca2 APN 5 150539516 missense possibly damaging 0.76
IGL01732:Brca2 APN 5 150542387 missense probably benign 0.13
IGL01809:Brca2 APN 5 150531061 splice site probably null
IGL01911:Brca2 APN 5 150567613 missense probably damaging 0.96
IGL02113:Brca2 APN 5 150540979 missense possibly damaging 0.95
IGL02313:Brca2 APN 5 150538661 missense probably damaging 1.00
IGL02342:Brca2 APN 5 150542824 missense possibly damaging 0.94
IGL02508:Brca2 APN 5 150543308 missense possibly damaging 0.85
IGL02532:Brca2 APN 5 150550862 missense probably damaging 1.00
IGL02646:Brca2 APN 5 150560790 missense possibly damaging 0.89
IGL02738:Brca2 APN 5 150567035 missense probably damaging 1.00
IGL02833:Brca2 APN 5 150541790 missense possibly damaging 0.83
IGL02871:Brca2 APN 5 150542552 missense probably benign 0.13
IGL02995:Brca2 APN 5 150529488 missense probably damaging 1.00
IGL03105:Brca2 APN 5 150560485 missense probably benign 0.02
BB007:Brca2 UTSW 5 150558510 missense probably damaging 0.96
BB017:Brca2 UTSW 5 150558510 missense probably damaging 0.96
R0219:Brca2 UTSW 5 150523175 splice site probably benign
R0416:Brca2 UTSW 5 150569392 missense possibly damaging 0.93
R0441:Brca2 UTSW 5 150541857 missense probably damaging 0.96
R0548:Brca2 UTSW 5 150544935 missense probably damaging 0.96
R0745:Brca2 UTSW 5 150544882 splice site probably benign
R0799:Brca2 UTSW 5 150560193 missense probably damaging 0.99
R1165:Brca2 UTSW 5 150542747 missense probably damaging 0.98
R1247:Brca2 UTSW 5 150541274 missense probably damaging 1.00
R1403:Brca2 UTSW 5 150542649 missense probably benign 0.22
R1403:Brca2 UTSW 5 150542649 missense probably benign 0.22
R1444:Brca2 UTSW 5 150542450 missense probably benign
R1466:Brca2 UTSW 5 150552258 missense probably damaging 0.99
R1466:Brca2 UTSW 5 150552258 missense probably damaging 0.99
R1584:Brca2 UTSW 5 150552258 missense probably damaging 0.99
R1599:Brca2 UTSW 5 150548713 nonsense probably null
R1600:Brca2 UTSW 5 150560830 splice site probably benign
R1822:Brca2 UTSW 5 150540198 missense probably benign 0.06
R1824:Brca2 UTSW 5 150536922 missense possibly damaging 0.94
R2037:Brca2 UTSW 5 150540669 missense probably benign
R2131:Brca2 UTSW 5 150557129 missense probably damaging 1.00
R2203:Brca2 UTSW 5 150539502 missense possibly damaging 0.58
R2208:Brca2 UTSW 5 150532344 missense probably damaging 0.96
R2293:Brca2 UTSW 5 150560534 missense possibly damaging 0.86
R2517:Brca2 UTSW 5 150539672 missense probably benign 0.04
R2566:Brca2 UTSW 5 150541762 missense probably benign 0.03
R3422:Brca2 UTSW 5 150543121 missense possibly damaging 0.91
R3917:Brca2 UTSW 5 150540827 missense probably damaging 0.96
R3946:Brca2 UTSW 5 150536704 missense probably damaging 0.96
R4176:Brca2 UTSW 5 150539633 nonsense probably null
R4255:Brca2 UTSW 5 150541169 missense possibly damaging 0.92
R4450:Brca2 UTSW 5 150536053 missense probably damaging 0.96
R4603:Brca2 UTSW 5 150536165 missense possibly damaging 0.86
R4681:Brca2 UTSW 5 150552398 splice site probably null
R4755:Brca2 UTSW 5 150559987 splice site probably null
R4762:Brca2 UTSW 5 150531116 missense probably benign 0.00
R4824:Brca2 UTSW 5 150539735 missense probably damaging 1.00
R4887:Brca2 UTSW 5 150556937 missense probably damaging 1.00
R5020:Brca2 UTSW 5 150560436 missense probably damaging 1.00
R5159:Brca2 UTSW 5 150542108 missense possibly damaging 0.93
R5216:Brca2 UTSW 5 150542980 missense probably damaging 0.99
R5269:Brca2 UTSW 5 150539223 missense possibly damaging 0.75
R5274:Brca2 UTSW 5 150539689 missense probably benign 0.00
R5589:Brca2 UTSW 5 150557132 missense possibly damaging 0.67
R5619:Brca2 UTSW 5 150557114 missense probably damaging 0.96
R5641:Brca2 UTSW 5 150556899 missense probably damaging 1.00
R5686:Brca2 UTSW 5 150540904 missense probably benign 0.00
R5730:Brca2 UTSW 5 150569005 missense possibly damaging 0.85
R5763:Brca2 UTSW 5 150548006 missense possibly damaging 0.85
R5877:Brca2 UTSW 5 150543221 missense possibly damaging 0.53
R5893:Brca2 UTSW 5 150569138 missense probably benign 0.02
R5900:Brca2 UTSW 5 150541132 missense probably benign 0.01
R5926:Brca2 UTSW 5 150534622 missense probably benign 0.07
R5966:Brca2 UTSW 5 150543251 missense probably damaging 0.99
R6025:Brca2 UTSW 5 150541575 frame shift probably null
R6062:Brca2 UTSW 5 150556889 missense probably damaging 0.96
R6141:Brca2 UTSW 5 150540637 missense possibly damaging 0.91
R6244:Brca2 UTSW 5 150566978 missense probably benign 0.08
R6508:Brca2 UTSW 5 150536593 missense possibly damaging 0.91
R6519:Brca2 UTSW 5 150540979 missense probably damaging 0.99
R6611:Brca2 UTSW 5 150536193 missense probably damaging 0.99
R6698:Brca2 UTSW 5 150532394 missense probably damaging 1.00
R6856:Brca2 UTSW 5 150540208 missense possibly damaging 0.68
R6912:Brca2 UTSW 5 150541742 missense probably damaging 0.99
R7002:Brca2 UTSW 5 150539918 missense probably benign
R7025:Brca2 UTSW 5 150540478 missense probably benign 0.39
R7151:Brca2 UTSW 5 150541436 missense probably benign 0.12
R7202:Brca2 UTSW 5 150532354 missense probably benign 0.03
R7365:Brca2 UTSW 5 150532337 missense probably damaging 0.99
R7510:Brca2 UTSW 5 150536691 missense possibly damaging 0.85
R7612:Brca2 UTSW 5 150540611 missense probably benign 0.03
R7682:Brca2 UTSW 5 150543153 missense probably benign
R7890:Brca2 UTSW 5 150539381 missense possibly damaging 0.83
R7930:Brca2 UTSW 5 150558510 missense probably damaging 0.96
R7940:Brca2 UTSW 5 150538733 missense probably benign
R8054:Brca2 UTSW 5 150536504 missense probably benign 0.02
R8056:Brca2 UTSW 5 150569306 missense possibly damaging 0.85
R8080:Brca2 UTSW 5 150539892 missense probably benign 0.11
R8094:Brca2 UTSW 5 150536169 missense possibly damaging 0.85
R8306:Brca2 UTSW 5 150536663 missense possibly damaging 0.91
R8401:Brca2 UTSW 5 150552352 missense probably damaging 1.00
R8523:Brca2 UTSW 5 150560148 missense possibly damaging 0.75
R8784:Brca2 UTSW 5 150548661 nonsense probably null
R8791:Brca2 UTSW 5 150542596 missense possibly damaging 0.92
R8832:Brca2 UTSW 5 150542146 missense possibly damaging 0.91
R8838:Brca2 UTSW 5 150541540 missense possibly damaging 0.91
R8898:Brca2 UTSW 5 150569033 missense possibly damaging 0.53
R8914:Brca2 UTSW 5 150541743 missense probably damaging 0.96
R8935:Brca2 UTSW 5 150568981 missense possibly damaging 0.70
R9014:Brca2 UTSW 5 150541754 missense probably benign
R9023:Brca2 UTSW 5 150541895 missense probably benign 0.07
R9094:Brca2 UTSW 5 150552305 missense probably benign 0.08
R9195:Brca2 UTSW 5 150539953 missense possibly damaging 0.83
R9198:Brca2 UTSW 5 150536512 missense possibly damaging 0.91
R9314:Brca2 UTSW 5 150550894 missense probably damaging 0.96
R9408:Brca2 UTSW 5 150541517 missense probably damaging 1.00
R9459:Brca2 UTSW 5 150540629 missense probably damaging 0.98
Z1088:Brca2 UTSW 5 150542763 missense probably damaging 0.96
Z1186:Brca2 UTSW 5 150536583 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CCCATAGTAAGGCTAATCTTTTGGG -3'
(R):5'- CTGTCTTCTAAACTCCACAGGG -3'

Sequencing Primer
(F):5'- GAAAAGAACAAACTTTACCCCAAAAC -3'
(R):5'- CTTGAGAGAGACCAGTAGA -3'
Posted On 2021-07-15