Incidental Mutation 'R8982:Psg18'
ID 683776
Institutional Source Beutler Lab
Gene Symbol Psg18
Ensembl Gene ENSMUSG00000003505
Gene Name pregnancy specific glycoprotein 18
Synonyms Cea-3, Cea3, mmCGM6
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.050) question?
Stock # R8982 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 18345422-18355009 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 18349375 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Leucine at position 285 (H285L)
Ref Sequence ENSEMBL: ENSMUSP00000003597 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003597] [ENSMUST00000098783]
AlphaFold B2RSG7
Predicted Effect probably benign
Transcript: ENSMUST00000003597
AA Change: H285L

PolyPhen 2 Score 0.198 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000003597
Gene: ENSMUSG00000003505
AA Change: H285L

DomainStartEndE-ValueType
low complexity region 19 30 N/A INTRINSIC
IG 40 140 2.11e-2 SMART
IG 161 262 1.03e0 SMART
IG 281 380 2.15e-3 SMART
IGc2 398 462 1.58e-10 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000098783
AA Change: H164L

PolyPhen 2 Score 0.504 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000096380
Gene: ENSMUSG00000003505
AA Change: H164L

DomainStartEndE-ValueType
IG 40 141 1.03e0 SMART
IG 160 259 2.15e-3 SMART
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl3 A G 1: 78,699,768 N493S probably benign Het
Actg2 T C 6: 83,520,715 D185G probably benign Het
Alpk3 A G 7: 81,099,002 N1439S probably damaging Het
Arid1b T A 17: 5,243,041 S745T probably damaging Het
Atxn2l CCAGCAGCAGCAGCAGCAGC CCAGCAGCAGCAGCAGC 7: 126,494,248 probably benign Het
BC030867 G A 11: 102,255,284 A129T probably benign Het
C4b A G 17: 34,734,364 probably null Het
Cenpc1 A G 5: 86,047,674 S79P probably damaging Het
Cep295nl A T 11: 118,333,845 W58R probably damaging Het
Ces2f T A 8: 104,953,035 C387S probably benign Het
Cfap74 G A 4: 155,436,730 E620K Het
Ckap5 T C 2: 91,607,578 V1668A possibly damaging Het
Clock A G 5: 76,216,712 V852A unknown Het
Col22a1 A G 15: 71,973,638 probably null Het
Copb2 T C 9: 98,574,111 S233P probably damaging Het
Dnah3 T C 7: 119,937,071 Y684C probably damaging Het
Dnah7a T C 1: 53,531,142 E1835G probably benign Het
F830045P16Rik T A 2: 129,472,892 Q155L probably damaging Het
Fhad1 T C 4: 142,002,584 D36G probably damaging Het
Gm13089 T G 4: 143,698,316 I186L probably benign Het
Hectd4 T C 5: 121,328,242 V2412A probably benign Het
Hoxa13 T A 6: 52,258,936 K210* probably null Het
Hoxc5 T C 15: 103,015,308 Y179H probably damaging Het
Htr1d A T 4: 136,443,555 Q365L possibly damaging Het
Krt72 C T 15: 101,781,624 V253M possibly damaging Het
Mecom G A 3: 29,963,106 T470I probably damaging Het
Nefh G A 11: 4,947,549 A129V probably damaging Het
Nlrp2 T A 7: 5,324,979 I692F probably damaging Het
Nr6a1 T A 2: 38,872,601 I61L probably benign Het
Olfr418 G A 1: 173,270,739 C188Y probably damaging Het
Olfr433 T G 1: 174,042,622 V224G probably damaging Het
Olfr73 A T 2: 88,034,269 I290K probably damaging Het
Pck1 T C 2: 173,157,319 V426A probably damaging Het
Pkhd1l1 T A 15: 44,523,673 L1314* probably null Het
Pogz G A 3: 94,879,568 V1156M probably damaging Het
Prrc2b T A 2: 32,212,122 C736S probably damaging Het
Ptprb GAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT GAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT 10: 116,283,677 probably benign Het
Ptprk A T 10: 28,560,142 D833V probably damaging Het
Rfx6 G A 10: 51,723,819 V554M probably benign Het
Rimbp3 A G 16: 17,209,647 T312A probably benign Het
Slfn5 G A 11: 82,960,140 W421* probably null Het
Srcin1 A G 11: 97,535,798 I291T probably damaging Het
Sult3a2 T C 10: 33,782,073 N15D probably damaging Het
Tmem179 A T 12: 112,501,867 L193Q probably damaging Het
Tmem200b T A 4: 131,922,357 L196Q probably damaging Het
Trim71 T C 9: 114,513,736 T493A possibly damaging Het
Trp53bp2 T A 1: 182,435,436 probably null Het
Zbtb7c G A 18: 76,146,273 G601S probably damaging Het
Zdhhc3 A G 9: 123,100,513 L19P probably benign Het
Zfp385b G T 2: 77,411,956 T473K probably damaging Het
Zfp651 A G 9: 121,763,268 E218G probably benign Het
Zfp804a A G 2: 82,235,828 K48E probably damaging Het
Other mutations in Psg18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01458:Psg18 APN 7 18354816 start codon destroyed probably null 0.99
IGL01748:Psg18 APN 7 18353551 missense probably benign 0.05
IGL01767:Psg18 APN 7 18353397 missense possibly damaging 0.80
IGL02727:Psg18 APN 7 18345950 missense probably damaging 1.00
IGL02744:Psg18 APN 7 18349402 missense probably benign 0.38
G1Funyon:Psg18 UTSW 7 18353377 missense probably damaging 0.99
PIT4466001:Psg18 UTSW 7 18349316 missense probably benign 0.30
R0331:Psg18 UTSW 7 18353308 missense probably benign 0.03
R1077:Psg18 UTSW 7 18351075 missense possibly damaging 0.84
R1171:Psg18 UTSW 7 18346079 missense probably benign 0.10
R1173:Psg18 UTSW 7 18354817 start codon destroyed probably null 0.97
R1234:Psg18 UTSW 7 18349190 missense probably damaging 1.00
R1553:Psg18 UTSW 7 18353481 missense probably benign 0.19
R1632:Psg18 UTSW 7 18350899 missense probably benign 0.02
R2108:Psg18 UTSW 7 18350874 missense probably damaging 1.00
R2439:Psg18 UTSW 7 18346119 missense probably benign 0.24
R3032:Psg18 UTSW 7 18350979 missense probably benign 0.01
R3053:Psg18 UTSW 7 18349193 missense probably damaging 1.00
R3432:Psg18 UTSW 7 18349171 missense possibly damaging 0.61
R3725:Psg18 UTSW 7 18354823 start gained probably benign
R4479:Psg18 UTSW 7 18350862 missense probably benign 0.01
R4480:Psg18 UTSW 7 18350862 missense probably benign 0.01
R4846:Psg18 UTSW 7 18350786 nonsense probably null
R4858:Psg18 UTSW 7 18353484 missense possibly damaging 0.49
R5010:Psg18 UTSW 7 18349354 missense probably damaging 1.00
R5225:Psg18 UTSW 7 18345949 missense probably damaging 1.00
R5450:Psg18 UTSW 7 18353425 missense probably benign 0.32
R5526:Psg18 UTSW 7 18349348 missense probably damaging 1.00
R5840:Psg18 UTSW 7 18346602 intron probably benign
R6409:Psg18 UTSW 7 18353521 missense probably benign
R7164:Psg18 UTSW 7 18350937 missense possibly damaging 0.89
R7276:Psg18 UTSW 7 18345984 missense probably damaging 0.99
R7768:Psg18 UTSW 7 18346028 missense probably damaging 1.00
R8301:Psg18 UTSW 7 18353377 missense probably damaging 0.99
R8700:Psg18 UTSW 7 18353625 missense probably damaging 1.00
R9042:Psg18 UTSW 7 18349122 missense probably benign 0.44
R9054:Psg18 UTSW 7 18353525 missense possibly damaging 0.82
R9442:Psg18 UTSW 7 18349260 nonsense probably null
Z1176:Psg18 UTSW 7 18354787 missense probably benign 0.07
Z1177:Psg18 UTSW 7 18349115 missense probably benign 0.30
Z1177:Psg18 UTSW 7 18349198 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- GGATCCGTTGGTGTACCCTATC -3'
(R):5'- ACTTCCTCCCGGTGAGATAGAC -3'

Sequencing Primer
(F):5'- GTTGGTGTACCCTATCTCTCTTCTG -3'
(R):5'- ATCCTGGTCTTATAGCACATGGGAC -3'
Posted On 2021-10-11