Incidental Mutation 'R9228:Abca12'
ID 699971
Institutional Source Beutler Lab
Gene Symbol Abca12
Ensembl Gene ENSMUSG00000050296
Gene Name ATP-binding cassette, sub-family A (ABC1), member 12
Synonyms 4833417A11Rik, 4832428G11Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9228 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 71242276-71414910 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 71293440 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 1254 (I1254N)
Ref Sequence ENSEMBL: ENSMUSP00000084523 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087268]
AlphaFold E9Q876
Predicted Effect probably damaging
Transcript: ENSMUST00000087268
AA Change: I1254N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000084523
Gene: ENSMUSG00000050296
AA Change: I1254N

DomainStartEndE-ValueType
transmembrane domain 24 43 N/A INTRINSIC
low complexity region 246 259 N/A INTRINSIC
Pfam:ABC2_membrane_3 885 1267 2.9e-24 PFAM
AAA 1370 1554 4.2e-10 SMART
low complexity region 1717 1735 N/A INTRINSIC
Pfam:ABC2_membrane_3 1744 2206 9.6e-35 PFAM
AAA 2282 2467 4.61e-7 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, and White). This encoded protein is a member of the ABC1 subfamily, which is the only major ABC subfamily found exclusively in multicellular eukaryotes. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit neonatal lethality associated with defective skin development and abnormal lung morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810037I17Rik G A 3: 122,924,625 A56T probably benign Het
2310050C09Rik C T 3: 92,868,644 G244D probably benign Het
4930438A08Rik A T 11: 58,287,470 I119F Het
Abcb11 G T 2: 69,308,465 Y157* probably null Het
Adcy7 G A 8: 88,318,047 probably null Het
Adnp A G 2: 168,184,878 Y166H probably damaging Het
Adprhl1 A G 8: 13,225,279 V493A probably benign Het
Ahctf1 T C 1: 179,784,120 T562A probably benign Het
Amotl1 T A 9: 14,593,024 N296I possibly damaging Het
Ankar A G 1: 72,674,051 V693A probably benign Het
Ankrd16 T C 2: 11,781,507 V189A probably benign Het
Bmp1 A G 14: 70,519,898 L47P probably benign Het
Cacna2d4 A G 6: 119,271,515 D429G probably benign Het
Cadps2 T A 6: 23,688,928 E127D probably benign Het
Cd109 A T 9: 78,669,760 I580F possibly damaging Het
Cdrt4 T A 11: 62,951,298 I2N unknown Het
Cep250 C T 2: 155,970,122 A446V unknown Het
Chuk A T 19: 44,107,350 W15R probably damaging Het
Cpvl C T 6: 53,974,794 M1I probably null Het
Cyfip1 A G 7: 55,900,010 M642V probably damaging Het
Dhh T A 15: 98,897,876 R133* probably null Het
Dnmt3b G A 2: 153,666,060 V212M probably benign Het
Dync2li1 A G 17: 84,649,709 S301G probably benign Het
Epas1 A C 17: 86,826,562 I500L possibly damaging Het
Ephb4 A T 5: 137,354,562 I136F possibly damaging Het
Foxg1 T C 12: 49,384,537 F18L unknown Het
Frem1 T C 4: 83,001,820 E432G probably damaging Het
Gm5591 T A 7: 38,528,061 M1L probably benign Het
Gpld1 A T 13: 24,952,917 S73C probably damaging Het
Hddc3 A G 7: 80,343,580 I52V probably benign Het
Hmgcll1 A T 9: 76,084,450 T252S probably damaging Het
Igsf10 G A 3: 59,336,422 R164W probably damaging Het
Jph2 A G 2: 163,338,686 V675A probably benign Het
Kifap3 T C 1: 163,862,097 F550S probably benign Het
Klk15 C T 7: 43,938,366 H73Y possibly damaging Het
L1td1 T C 4: 98,737,695 V643A possibly damaging Het
L3mbtl3 C T 10: 26,336,257 M255I unknown Het
Layn T A 9: 51,057,537 D302V probably damaging Het
Lpcat4 A G 2: 112,242,073 I136V possibly damaging Het
Lrp1 T A 10: 127,546,938 D3658V probably damaging Het
Metap1d T C 2: 71,522,556 L243S possibly damaging Het
Midn T A 10: 80,154,441 H315Q probably damaging Het
Myb C T 10: 21,154,713 D62N probably benign Het
Myh2 T C 11: 67,186,696 S886P probably benign Het
Nemf T C 12: 69,341,319 I396V probably damaging Het
Nemp1 T G 10: 127,689,358 V127G possibly damaging Het
Nkx3-1 C T 14: 69,190,778 T25M possibly damaging Het
Nmral1 A C 16: 4,713,767 L208R probably damaging Het
Nol6 A T 4: 41,116,422 I989N probably benign Het
Olfr1126 T A 2: 87,457,563 C133S possibly damaging Het
Palld A T 8: 61,720,537 S363T probably damaging Het
Pcdha11 A G 18: 37,011,459 D201G probably damaging Het
Per2 A G 1: 91,438,359 C339R probably damaging Het
Phactr4 T C 4: 132,370,563 T455A possibly damaging Het
Phc2 T C 4: 128,723,269 I445T probably damaging Het
Polr1a T C 6: 71,954,771 F945L probably damaging Het
Ppp2r5e T A 12: 75,593,289 K13* probably null Het
Ptafr T C 4: 132,579,302 M1T probably null Het
Rbms1 G A 2: 60,779,743 P208S probably benign Het
Scg3 T A 9: 75,651,673 I419F probably damaging Het
Scn1a T C 2: 66,299,755 T219A probably benign Het
Sec14l4 A G 11: 4,039,977 D92G probably damaging Het
Senp3 G T 11: 69,678,259 Q359K probably damaging Het
Sirt1 T C 10: 63,337,078 D142G probably damaging Het
Skint2 T C 4: 112,625,842 M148T possibly damaging Het
Skiv2l2 A T 13: 112,914,354 probably null Het
Slc30a10 T A 1: 185,455,194 M44K probably damaging Het
Snai2 T A 16: 14,706,928 D99E probably damaging Het
Spg7 A G 8: 123,080,669 K395E possibly damaging Het
Sphk2 G A 7: 45,710,913 H556Y possibly damaging Het
Supt6 A C 11: 78,225,786 F637L probably benign Het
Tcam1 A G 11: 106,286,466 N428S probably damaging Het
Tctn3 C T 19: 40,608,248 R276K probably benign Het
Timm29 G A 9: 21,593,360 R108H probably damaging Het
Tlr9 A T 9: 106,225,553 E681V possibly damaging Het
Tmco1 C T 1: 167,308,563 probably benign Het
Tns3 T C 11: 8,450,094 K1169E probably damaging Het
Trim72 A C 7: 128,009,143 D271A possibly damaging Het
Trpv4 A T 5: 114,634,561 D369E probably benign Het
Ttn A G 2: 76,752,848 L22567P probably damaging Het
Uimc1 G A 13: 55,075,839 P207S probably damaging Het
Unc5d A T 8: 28,675,420 V781E probably damaging Het
Upk3bl C T 5: 136,057,222 P4L unknown Het
Vmn1r201 A G 13: 22,475,500 N295D probably benign Het
Vmn2r69 A G 7: 85,415,489 I63T probably benign Het
Zfyve28 T C 5: 34,217,444 T409A probably benign Het
Other mutations in Abca12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Abca12 APN 1 71303541 missense possibly damaging 0.64
IGL00556:Abca12 APN 1 71353757 missense probably benign 0.00
IGL00813:Abca12 APN 1 71353762 critical splice acceptor site probably null
IGL00835:Abca12 APN 1 71302733 missense probably damaging 1.00
IGL00921:Abca12 APN 1 71285729 missense probably damaging 1.00
IGL01011:Abca12 APN 1 71263632 missense probably benign 0.02
IGL01066:Abca12 APN 1 71353730 missense possibly damaging 0.95
IGL01082:Abca12 APN 1 71314114 missense probably damaging 1.00
IGL01310:Abca12 APN 1 71284156 missense probably benign 0.00
IGL01360:Abca12 APN 1 71286489 missense possibly damaging 0.95
IGL01585:Abca12 APN 1 71319886 missense probably benign 0.00
IGL01608:Abca12 APN 1 71259442 missense probably damaging 1.00
IGL01687:Abca12 APN 1 71267610 splice site probably benign
IGL01700:Abca12 APN 1 71280390 missense probably benign
IGL01723:Abca12 APN 1 71314168 missense probably benign 0.01
IGL01804:Abca12 APN 1 71276183 missense probably benign 0.01
IGL01982:Abca12 APN 1 71346698 missense probably benign 0.34
IGL02136:Abca12 APN 1 71247142 missense probably damaging 1.00
IGL02172:Abca12 APN 1 71302658 missense probably benign 0.09
IGL02222:Abca12 APN 1 71282886 missense probably benign 0.40
IGL02266:Abca12 APN 1 71268201 nonsense probably null
IGL02449:Abca12 APN 1 71401749 splice site probably null
IGL02471:Abca12 APN 1 71258198 missense probably benign 0.00
IGL02496:Abca12 APN 1 71288553 missense possibly damaging 0.55
IGL02552:Abca12 APN 1 71294747 missense probably damaging 0.96
IGL02795:Abca12 APN 1 71288748 missense probably damaging 1.00
IGL03000:Abca12 APN 1 71321800 missense probably benign 0.01
IGL03031:Abca12 APN 1 71314024 missense probably benign 0.00
IGL03131:Abca12 APN 1 71346702 missense probably benign
IGL03260:Abca12 APN 1 71284099 missense probably damaging 1.00
IGL03324:Abca12 APN 1 71314008 missense probably benign
IGL03408:Abca12 APN 1 71264795 missense probably damaging 1.00
R0016:Abca12 UTSW 1 71294800 missense probably benign 0.35
R0016:Abca12 UTSW 1 71294800 missense probably benign 0.35
R0121:Abca12 UTSW 1 71259786 splice site probably null
R0172:Abca12 UTSW 1 71279402 missense probably damaging 0.99
R0196:Abca12 UTSW 1 71259813 missense possibly damaging 0.81
R0400:Abca12 UTSW 1 71259776 splice site probably benign
R0466:Abca12 UTSW 1 71302663 missense probably damaging 1.00
R0616:Abca12 UTSW 1 71302671 missense probably damaging 1.00
R0668:Abca12 UTSW 1 71263614 missense probably damaging 1.00
R0928:Abca12 UTSW 1 71349174 missense probably benign 0.06
R1036:Abca12 UTSW 1 71263410 critical splice donor site probably null
R1086:Abca12 UTSW 1 71295061 splice site probably benign
R1300:Abca12 UTSW 1 71244808 missense probably damaging 1.00
R1337:Abca12 UTSW 1 71294819 missense probably benign 0.03
R1356:Abca12 UTSW 1 71302953 splice site probably benign
R1372:Abca12 UTSW 1 71294857 missense probably damaging 1.00
R1434:Abca12 UTSW 1 71309800 missense probably benign 0.00
R1580:Abca12 UTSW 1 71265965 missense possibly damaging 0.65
R1675:Abca12 UTSW 1 71263411 critical splice donor site probably null
R1773:Abca12 UTSW 1 71288596 missense probably damaging 1.00
R1829:Abca12 UTSW 1 71295029 missense probably benign 0.26
R1922:Abca12 UTSW 1 71319924 missense probably benign 0.10
R1927:Abca12 UTSW 1 71244840 missense probably damaging 1.00
R2115:Abca12 UTSW 1 71244771 missense probably benign 0.01
R2146:Abca12 UTSW 1 71263488 missense probably benign 0.02
R2148:Abca12 UTSW 1 71263488 missense probably benign 0.02
R2149:Abca12 UTSW 1 71263488 missense probably benign 0.02
R2150:Abca12 UTSW 1 71263488 missense probably benign 0.02
R2299:Abca12 UTSW 1 71258222 missense probably damaging 1.00
R2392:Abca12 UTSW 1 71258105 missense probably damaging 1.00
R2571:Abca12 UTSW 1 71249885 missense probably benign 0.00
R3077:Abca12 UTSW 1 71267605 missense probably benign 0.02
R3078:Abca12 UTSW 1 71267605 missense probably benign 0.02
R3705:Abca12 UTSW 1 71285705 missense probably damaging 1.00
R3800:Abca12 UTSW 1 71265887 missense probably damaging 1.00
R3905:Abca12 UTSW 1 71268230 missense possibly damaging 0.79
R3905:Abca12 UTSW 1 71279457 missense probably benign 0.02
R3962:Abca12 UTSW 1 71274515 splice site probably null
R4082:Abca12 UTSW 1 71267463 missense possibly damaging 0.64
R4131:Abca12 UTSW 1 71319871 critical splice donor site probably null
R4214:Abca12 UTSW 1 71288697 missense probably damaging 0.99
R4403:Abca12 UTSW 1 71267436 missense probably damaging 1.00
R4524:Abca12 UTSW 1 71302917 missense probably benign 0.19
R4615:Abca12 UTSW 1 71330334 missense probably benign
R4617:Abca12 UTSW 1 71330334 missense probably benign
R4714:Abca12 UTSW 1 71321450 missense probably benign 0.00
R4809:Abca12 UTSW 1 71278856 missense probably benign 0.10
R4810:Abca12 UTSW 1 71303612 missense probably benign 0.00
R4825:Abca12 UTSW 1 71302685 missense possibly damaging 0.70
R4990:Abca12 UTSW 1 71294939 missense possibly damaging 0.61
R5013:Abca12 UTSW 1 71264767 missense probably damaging 0.99
R5026:Abca12 UTSW 1 71317224 missense probably benign 0.04
R5064:Abca12 UTSW 1 71300960 missense probably damaging 1.00
R5188:Abca12 UTSW 1 71291492 missense probably benign 0.23
R5234:Abca12 UTSW 1 71263664 missense probably damaging 0.99
R5267:Abca12 UTSW 1 71335774 splice site probably benign
R5302:Abca12 UTSW 1 71283952 missense possibly damaging 0.91
R5441:Abca12 UTSW 1 71295056 missense probably damaging 1.00
R5451:Abca12 UTSW 1 71294917 missense possibly damaging 0.94
R5526:Abca12 UTSW 1 71292446 missense probably benign 0.29
R5529:Abca12 UTSW 1 71264881 missense probably damaging 1.00
R5615:Abca12 UTSW 1 71307059 missense probably damaging 1.00
R5649:Abca12 UTSW 1 71291342 missense probably damaging 1.00
R5800:Abca12 UTSW 1 71321432 missense possibly damaging 0.78
R5807:Abca12 UTSW 1 71303492 missense probably damaging 1.00
R5878:Abca12 UTSW 1 71346633 missense possibly damaging 0.79
R5987:Abca12 UTSW 1 71258098 missense probably damaging 1.00
R6280:Abca12 UTSW 1 71272460 missense probably benign 0.04
R6316:Abca12 UTSW 1 71313959 missense probably benign 0.01
R6337:Abca12 UTSW 1 71295013 missense probably damaging 1.00
R6383:Abca12 UTSW 1 71247184 missense probably benign 0.03
R6564:Abca12 UTSW 1 71309850 missense possibly damaging 0.57
R6582:Abca12 UTSW 1 71258225 missense probably benign 0.00
R6756:Abca12 UTSW 1 71259353 splice site probably null
R6876:Abca12 UTSW 1 71263508 missense probably damaging 0.98
R6999:Abca12 UTSW 1 71317162 nonsense probably null
R7145:Abca12 UTSW 1 71307053 missense possibly damaging 0.92
R7272:Abca12 UTSW 1 71248432 missense probably damaging 0.99
R7285:Abca12 UTSW 1 71349155 nonsense probably null
R7421:Abca12 UTSW 1 71247136 nonsense probably null
R7531:Abca12 UTSW 1 71247173 missense probably damaging 0.99
R7592:Abca12 UTSW 1 71288677 missense probably benign 0.01
R7687:Abca12 UTSW 1 71258182 missense probably benign 0.00
R7690:Abca12 UTSW 1 71314154 missense probably benign 0.00
R7709:Abca12 UTSW 1 71335728 missense probably benign 0.00
R7736:Abca12 UTSW 1 71319964 missense probably benign 0.01
R7754:Abca12 UTSW 1 71302887 missense probably benign
R7761:Abca12 UTSW 1 71330288 missense probably damaging 1.00
R7808:Abca12 UTSW 1 71274634 splice site probably null
R7816:Abca12 UTSW 1 71292429 missense probably benign 0.01
R7821:Abca12 UTSW 1 71259791 missense probably benign 0.12
R7827:Abca12 UTSW 1 71414678 start gained probably benign
R7829:Abca12 UTSW 1 71292421 missense probably benign 0.37
R7863:Abca12 UTSW 1 71293497 missense probably damaging 0.96
R8053:Abca12 UTSW 1 71349169 nonsense probably null
R8093:Abca12 UTSW 1 71280393 missense probably benign 0.00
R8120:Abca12 UTSW 1 71259381 missense possibly damaging 0.92
R8136:Abca12 UTSW 1 71248397 missense probably benign 0.15
R8155:Abca12 UTSW 1 71291338 missense probably damaging 1.00
R8189:Abca12 UTSW 1 71285726 missense probably damaging 1.00
R8233:Abca12 UTSW 1 71351757 missense probably benign 0.00
R8249:Abca12 UTSW 1 71321812 missense probably benign 0.00
R8255:Abca12 UTSW 1 71319899 missense probably benign 0.13
R8300:Abca12 UTSW 1 71313964 missense possibly damaging 0.77
R8339:Abca12 UTSW 1 71285672 missense probably damaging 1.00
R8490:Abca12 UTSW 1 71284097 missense probably damaging 1.00
R8494:Abca12 UTSW 1 71288662 missense probably benign 0.02
R8527:Abca12 UTSW 1 71309888 critical splice acceptor site probably null
R8542:Abca12 UTSW 1 71309888 critical splice acceptor site probably null
R8692:Abca12 UTSW 1 71288715 missense probably damaging 0.96
R8723:Abca12 UTSW 1 71321738 missense probably benign 0.04
R8796:Abca12 UTSW 1 71258089 critical splice donor site probably benign
R8911:Abca12 UTSW 1 71341531 missense probably benign 0.07
R8913:Abca12 UTSW 1 71264813 missense probably damaging 1.00
R8957:Abca12 UTSW 1 71321625 missense possibly damaging 0.90
R9000:Abca12 UTSW 1 71314036 missense probably damaging 1.00
R9137:Abca12 UTSW 1 71259366 missense possibly damaging 0.80
R9237:Abca12 UTSW 1 71279398 missense probably damaging 0.97
R9299:Abca12 UTSW 1 71319883 missense possibly damaging 0.48
R9419:Abca12 UTSW 1 71303490 missense possibly damaging 0.81
X0013:Abca12 UTSW 1 71248433 missense probably damaging 0.99
X0018:Abca12 UTSW 1 71314510 missense probably benign
X0063:Abca12 UTSW 1 71349064 missense probably benign 0.15
X0065:Abca12 UTSW 1 71341461 critical splice donor site probably null
Z1176:Abca12 UTSW 1 71284070 missense probably damaging 1.00
Z1177:Abca12 UTSW 1 71276082 missense possibly damaging 0.94
Z1177:Abca12 UTSW 1 71282811 missense probably damaging 0.98
Z1177:Abca12 UTSW 1 71292531 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GAGACACAGCGACAAATTTAACCTG -3'
(R):5'- GCAAGCCAATATATTGCACGG -3'

Sequencing Primer
(F):5'- GCGACAAATTTAACCTGAACAATTTG -3'
(R):5'- GCCAATATATTGCACGGTATGAAG -3'
Posted On 2022-02-07