Incidental Mutation 'R0738:Mid2'
ID70598
Institutional Source Beutler Lab
Gene Symbol Mid2
Ensembl Gene ENSMUSG00000000266
Gene Namemidline 2
SynonymsTrim1, FXY2
MMRRC Submission 038919-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.166) question?
Stock #R0738 (G1)
Quality Score222
Status Validated
ChromosomeX
Chromosomal Location140664599-140767715 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 140763676 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 618 (Y618C)
Ref Sequence ENSEMBL: ENSMUSP00000108617 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112988] [ENSMUST00000112990] [ENSMUST00000112993]
Predicted Effect probably damaging
Transcript: ENSMUST00000112988
AA Change: Y648C

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000108612
Gene: ENSMUSG00000000266
AA Change: Y648C

DomainStartEndE-ValueType
RING 10 59 2.53e-6 SMART
BBOX 114 164 1.96e-3 SMART
BBOX 170 212 1.09e-10 SMART
BBC 219 345 1.81e-33 SMART
FN3 382 502 2.28e-5 SMART
SPRY 568 686 1.4e-32 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000112990
AA Change: Y618C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000108614
Gene: ENSMUSG00000000266
AA Change: Y618C

DomainStartEndE-ValueType
RING 10 59 2.53e-6 SMART
BBOX 114 164 1.96e-3 SMART
BBOX 170 212 1.09e-10 SMART
BBC 219 345 1.81e-33 SMART
FN3 382 472 1.4e-5 SMART
SPRY 538 656 1.4e-32 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000112993
AA Change: Y618C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000108617
Gene: ENSMUSG00000000266
AA Change: Y618C

DomainStartEndE-ValueType
RING 10 59 2.53e-6 SMART
BBOX 114 164 1.96e-3 SMART
BBOX 170 212 1.09e-10 SMART
BBC 219 345 1.81e-33 SMART
FN3 382 472 1.4e-5 SMART
SPRY 538 656 1.4e-32 SMART
Meta Mutation Damage Score 0.8091 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.6%
  • 20x: 92.3%
Validation Efficiency 98% (46/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. The protein localizes to microtubular structures in the cytoplasm. Alternate splicing of this gene results in two transcript variants encoding different isoforms. [provided by RefSeq, Feb 2009]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930011G23Rik A T 5: 99,240,953 M189K probably benign Het
Ank1 A T 8: 23,114,114 E964D probably damaging Het
Ankhd1 A G 18: 36,645,249 probably benign Het
Cd9 G T 6: 125,462,140 Q169K probably benign Het
Cdc42bpa T A 1: 179,999,462 probably benign Het
Ch25h T C 19: 34,474,387 N247S possibly damaging Het
Dctn1 T C 6: 83,190,107 probably null Het
Defa22 C T 8: 21,162,375 T19I probably benign Het
Dscam T C 16: 96,819,781 N576D possibly damaging Het
Epha3 T C 16: 63,595,612 M675V probably damaging Het
Fam241a C A 3: 127,870,793 A120S possibly damaging Het
Fkbp8 T A 8: 70,529,670 I86N probably damaging Het
Herc4 C T 10: 63,289,149 P514L possibly damaging Het
Ide A T 19: 37,277,965 L813* probably null Het
Igkv12-41 G A 6: 69,858,691 Q26* probably null Het
Itsn2 T C 12: 4,635,681 V483A probably benign Het
Kcp A T 6: 29,490,439 I1002N probably benign Het
Lrfn5 G T 12: 61,840,592 E389* probably null Het
Lrp6 G T 6: 134,542,045 A19E probably benign Het
Mad1l1 A G 5: 140,300,560 L228P probably damaging Het
Map2 T C 1: 66,425,189 probably benign Het
Med13l T A 5: 118,751,633 Y1820N probably damaging Het
Mgam A G 6: 40,754,935 N735S probably benign Het
Mllt11 G A 3: 95,220,286 Q58* probably null Het
Mttp A G 3: 138,103,313 V678A probably damaging Het
Nfatc1 A G 18: 80,697,910 S278P probably damaging Het
Ninj2 A G 6: 120,198,137 probably benign Het
Nsd3 T A 8: 25,678,709 probably null Het
Olfr1454 A T 19: 13,063,738 E109V probably damaging Het
Olfr895 T C 9: 38,269,125 V204A possibly damaging Het
Pcdhb4 A G 18: 37,308,711 N358S probably damaging Het
Plch1 T C 3: 63,702,553 probably benign Het
Popdc3 T C 10: 45,315,258 L155P probably damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rbm26 A T 14: 105,176,782 I24N unknown Het
Rc3h2 T A 2: 37,405,374 D210V probably damaging Het
Samd1 CGAGGAGGAGGAGGAGGAGGA CGAGGAGGAGGAGGAGGA 8: 83,998,996 probably benign Het
Spopl T C 2: 23,537,521 T200A probably benign Het
Tarbp1 A G 8: 126,438,801 probably null Het
Thnsl1 T A 2: 21,213,362 H121Q probably damaging Het
Tll1 T C 8: 64,101,950 D233G probably damaging Het
Vmn2r27 A T 6: 124,223,702 V432E possibly damaging Het
Wdr5 T C 2: 27,519,412 S49P probably damaging Het
Zfyve26 A T 12: 79,295,534 I46N probably damaging Het
Other mutations in Mid2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02072:Mid2 APN X 140736452 missense probably damaging 1.00
IGL02234:Mid2 APN X 140763669 missense probably damaging 0.99
IGL02367:Mid2 APN X 140736496 missense probably damaging 1.00
R4789:Mid2 UTSW X 140678232 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGATTGGCAAGAATGCCTCTTCCTG -3'
(R):5'- GGTGGCACAAACCCAGACTATTCAG -3'

Sequencing Primer
(F):5'- GGGTCTTCTCTCGATGCAAC -3'
(R):5'- TCGAGTGCTTCCAATGGAC -3'
Posted On2013-09-30