Mutagenetix > Incidental Mutations

Incidental Mutation 'R0738:Ide'

474092

Institutional Source

Beutler Lab

Gene Symbol

Ide

Ensembl Gene

ENSMUSG00000056999

Gene Name

insulin degrading enzyme

Synonyms

MMRRC Submission

038919-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0738 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

37268743-37337852 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

A to T at 37277965 bp

Zygosity

Heterozygous

Amino Acid Change

Leucine to Stop codon at position 813 (L813*)

Gene Model

predicted gene model for transcript(s):

Predicted Effect

probably null
Transcript: ENSMUST00000131070
AA Change: L813*

SMART Domains

Protein: ENSMUSP00000121358
Gene: ENSMUSG00000056999
AA Change: L813*

Domain	Start	End	E-Value	Type
Pfam:Peptidase_M16	42	180	8.1e-49	PFAM
Pfam:Peptidase_M16_C	205	385	2.1e-25	PFAM
Pfam:Peptidase_M16_M	389	671	1.9e-106	PFAM
Pfam:Peptidase_M16_C	674	857	9.4e-16	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134740

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000154339

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 96.6%
20x: 92.3%

Validation Efficiency

98% (46/47)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a zinc metallopeptidase that degrades intracellular insulin, and thereby terminates insulins activity, as well as participating in intercellular peptide signalling by degrading diverse peptides such as glucagon, amylin, bradykinin, and kallidin. The preferential affinity of this enzyme for insulin results in insulin-mediated inhibition of the degradation of other peptides such as beta-amyloid. Deficiencies in this protein's function are associated with Alzheimer's disease and type 2 diabetes mellitus but mutations in this gene have not been shown to be causitive for these diseases. This protein localizes primarily to the cytoplasm but in some cell types localizes to the extracellular space, cell membrane, peroxisome, and mitochondrion. Alternative splicing results in multiple transcript variants encoding distinct isoforms. Additional transcript variants have been described but have not been experimentally verified.[provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for a disruption of this gene display beta amyloid accumulations in the brain, hyperinsulinemia and glucose intolerance. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A930011G23Rik	A	T	5: 99,240,953	M189K	probably benign	Het
Ank1	A	T	8: 23,114,114	E964D	probably damaging	Het
Ankhd1	A	G	18: 36,645,249		probably benign	Het
Cd9	G	T	6: 125,462,140	Q169K	probably benign	Het
Cdc42bpa	T	A	1: 179,999,462		probably benign	Het
Ch25h	T	C	19: 34,474,387	N247S	possibly damaging	Het
Dctn1	T	C	6: 83,190,107		probably null	Het
Defa22	C	T	8: 21,162,375	T19I	probably benign	Het
Dscam	T	C	16: 96,819,781	N576D	possibly damaging	Het
Epha3	T	C	16: 63,595,612	M675V	probably damaging	Het
Fam241a	C	A	3: 127,870,793	A120S	possibly damaging	Het
Fkbp8	T	A	8: 70,529,670	I86N	probably damaging	Het
Herc4	C	T	10: 63,289,149	P514L	possibly damaging	Het
Igkv12-41	G	A	6: 69,858,691	Q26*	probably null	Het
Itsn2	T	C	12: 4,635,681	V483A	probably benign	Het
Kcp	A	T	6: 29,490,439	I1002N	probably benign	Het
Lrfn5	G	T	12: 61,840,592	E389*	probably null	Het
Lrp6	G	T	6: 134,542,045	A19E	probably benign	Het
Mad1l1	A	G	5: 140,300,560	L228P	probably damaging	Het
Map2	T	C	1: 66,425,189		probably benign	Het
Med13l	T	A	5: 118,751,633	Y1820N	probably damaging	Het
Mgam	A	G	6: 40,754,935	N735S	probably benign	Het
Mid2	A	G	X: 140,763,676	Y618C	probably damaging	Het
Mllt11	G	A	3: 95,220,286	Q58*	probably null	Het
Mttp	A	G	3: 138,103,313	V678A	probably damaging	Het
Nfatc1	A	G	18: 80,697,910	S278P	probably damaging	Het
Ninj2	A	G	6: 120,198,137		probably benign	Het
Nsd3	T	A	8: 25,678,709		probably null	Het
Olfr1454	A	T	19: 13,063,738	E109V	probably damaging	Het
Olfr895	T	C	9: 38,269,125	V204A	possibly damaging	Het
Pcdhb4	A	G	18: 37,308,711	N358S	probably damaging	Het
Plch1	T	C	3: 63,702,553		probably benign	Het
Popdc3	T	C	10: 45,315,258	L155P	probably damaging	Het
Ptpro	T	A	6: 137,443,594	V1007D	probably damaging	Het
Rbm26	A	T	14: 105,176,782	I24N	unknown	Het
Rc3h2	T	A	2: 37,405,374	D210V	probably damaging	Het
Samd1	CGAGGAGGAGGAGGAGGAGGA	CGAGGAGGAGGAGGAGGA	8: 83,998,996		probably benign	Het
Spopl	T	C	2: 23,537,521	T200A	probably benign	Het
Tarbp1	A	G	8: 126,438,801		probably null	Het
Thnsl1	T	A	2: 21,213,362	H121Q	probably damaging	Het
Tll1	T	C	8: 64,101,950	D233G	probably damaging	Het
Vmn2r27	A	T	6: 124,223,702	V432E	possibly damaging	Het
Wdr5	T	C	2: 27,519,412	S49P	probably damaging	Het
Zfyve26	A	T	12: 79,295,534	I46N	probably damaging	Het

Other mutations in Ide

Allele	Source	Chr	Coord	Type	Predicted Effect
IGL00422:Ide	APN	19	37276532	missense	unknown
IGL01924:Ide	APN	19	37272164	missense	unknown
IGL01925:Ide	APN	19	37277897	missense	unknown
IGL02616:Ide	APN	19	37298056	missense	unknown
R1509:Ide	UTSW	19	37285204	critical splice donor site	probably null
R1557:Ide	UTSW	19	37280761	splice site	probably null
R2935:Ide	UTSW	19	37325307	missense	unknown
R4260:Ide	UTSW	19	37329186	missense	unknown
R4261:Ide	UTSW	19	37329186	missense	unknown
R4575:Ide	UTSW	19	37272205	missense	unknown
R4913:Ide	UTSW	19	37329070	missense	unknown
R4933:Ide	UTSW	19	37277756	missense	unknown
R4951:Ide	UTSW	19	37285232	missense	unknown
R5102:Ide	UTSW	19	37314984	missense	unknown
R5474:Ide	UTSW	19	37272184	missense	unknown
R5502:Ide	UTSW	19	37330456	missense	unknown
R5546:Ide	UTSW	19	37272224	missense	unknown
R5601:Ide	UTSW	19	37314980	missense	unknown
R5696:Ide	UTSW	19	37318021	missense	unknown
R5884:Ide	UTSW	19	37272153	critical splice donor site	probably null
R5983:Ide	UTSW	19	37272150	splice site	probably null
R6286:Ide	UTSW	19	37278010	missense	unknown
R7146:Ide	UTSW	19	37295944	missense
R7224:Ide	UTSW	19	37290761	missense
R7234:Ide	UTSW	19	37290785	missense
R7695:Ide	UTSW	19	37329036	missense
R7771:Ide	UTSW	19	37298126	missense
R7811:Ide	UTSW	19	37330511	missense
R7893:Ide	UTSW	19	37284151	missense
R8289:Ide	UTSW	19	37313553	missense
R8289:Ide	UTSW	19	37313554	missense	probably null
R8359:Ide	UTSW	19	37330487	missense
R8421:Ide	UTSW	19	37278004	missense
Z1176:Ide	UTSW	19	37315491	missense

Predicted Primers

Posted On

2017-04-14