Mutagenetix > Incidental Mutations

Incidental Mutation 'R7538:Taf4b'

583758

Institutional Source

Beutler Lab

Gene Symbol

Taf4b

Ensembl Gene

ENSMUSG00000054321

Gene Name

TATA-box binding protein associated factor 4b

Synonyms

Taf2c2, TAFII105, 2610524B04Rik, 105kDa, 4932409F03Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.481) question?

Stock #

R7538 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

14783245-14900359 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 14813545 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 475 (L475P)

Ref Sequence

ENSEMBL: ENSMUSP00000126909 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000169862]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000169862
AA Change: L475P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000126909
Gene: ENSMUSG00000054321
AA Change: L475P

Domain	Start	End	E-Value	Type
low complexity region	8	23	N/A	INTRINSIC
low complexity region	185	196	N/A	INTRINSIC
Pfam:TAFH	257	348	5.3e-39	PFAM
low complexity region	359	376	N/A	INTRINSIC
low complexity region	412	422	N/A	INTRINSIC
Pfam:TAF4	610	852	4e-72	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

97% (77/79)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] TATA binding protein (TBP) and TBP-associated factors (TAFs) participate in the formation of the TFIID protein complex, which is involved in initiation of transcription of genes by RNA polymerase II. This gene encodes a cell type-specific TAF that may be responsible for mediating transcription by a subset of activators in B cells. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jun 2014]
PHENOTYPE: Homozygotes for a targeted null mutation are infertile due to a granulosa cell defect preventing normal follicle formation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamts8	C	A	9: 30,953,470	P419H	probably damaging	Het
Adgra3	C	T	5: 49,961,450	V919I	probably benign	Het
Akap12	G	A	10: 4,353,213	V113I	probably damaging	Het
Akr1d1	T	A	6: 37,536,108	I113K	probably benign	Het
Alx3	A	T	3: 107,604,364	I230F	probably damaging	Het
Apob	A	T	12: 8,002,219	D1220V	probably damaging	Het
Ascc3	T	C	10: 50,845,700	L2083P	probably damaging	Het
Atp10b	A	G	11: 43,225,546	I907V	probably benign	Het
B4galnt3	G	T	6: 120,294,423	S46*	probably null	Het
Bfsp1	A	C	2: 143,831,835		probably null	Het
Cant1	G	A	11: 118,411,465	R9W	possibly damaging	Het
Ccdc88a	A	T	11: 29,463,370	H636L	probably benign	Het
Cfi	G	A	3: 129,858,815	R297H	probably benign	Het
Cherp	T	A	8: 72,462,419	Q749L		Het
Clec10a	A	G	11: 70,169,778	D153G	probably benign	Het
Cnga1	T	C	5: 72,612,380	K99E	probably benign	Het
Cyp2r1	A	T	7: 114,562,767	V64D	probably damaging	Het
Dact3	T	A	7: 16,875,518	W32R	probably damaging	Het
Dennd4c	T	C	4: 86,774,516	C88R	probably damaging	Het
Dock8	A	T	19: 25,158,418	D1200V	probably damaging	Het
Drosha	C	G	15: 12,926,243	S1262W	probably damaging	Het
Dtnb	T	C	12: 3,773,611	M592T	possibly damaging	Het
Eef2k	T	A	7: 120,891,992	V567E	probably benign	Het
Fem1b	A	G	9: 62,811,167	S47P	probably damaging	Het
Fryl	T	C	5: 73,022,676	E2864G	probably benign	Het
Fscn2	A	G	11: 120,367,326	N358S	possibly damaging	Het
Fsip2	T	C	2: 82,988,550	S4876P	possibly damaging	Het
Ggh	C	G	4: 20,049,833	S88C	probably damaging	Het
Grhl2	T	C	15: 37,328,359	Y410H	probably damaging	Het
Gucy2c	C	T	6: 136,709,744	G831D	probably damaging	Het
Hars	A	T	18: 36,771,141	D228E	probably benign	Het
Hdhd5	T	C	6: 120,521,296	D114G	possibly damaging	Het
Kcna2	A	G	3: 107,104,568	Y155C	probably benign	Het
Klc1	A	G	12: 111,785,445	K441R	probably benign	Het
Kmt2a	A	G	9: 44,847,744	L936P	probably damaging	Het
Map3k6	T	C	4: 133,251,927	V1197A	probably benign	Het
Mthfsd	C	T	8: 121,098,786	A349T	probably benign	Het
Mtmr7	G	A	8: 40,597,384	R123W	probably damaging	Het
Muc16	T	A	9: 18,642,131	I4289F	probably benign	Het
Muc16	G	A	9: 18,655,451	T1924I	unknown	Het
Mybpc3	A	C	2: 91,120,487	D220A	probably damaging	Het
Neb	A	T	2: 52,256,575		probably null	Het
Nectin2	A	G	7: 19,730,619	W287R	probably damaging	Het
Nipsnap1	A	T	11: 4,884,089	T114S	probably damaging	Het
Nol9	T	C	4: 152,039,658	S102P	probably benign	Het
Olfml2b	A	T	1: 170,649,833	K179I	possibly damaging	Het
Olfr1253	G	T	2: 89,752,321	P169H	probably damaging	Het
Pcnt	T	C	10: 76,399,939	M1403V	probably benign	Het
Phf7	T	C	14: 31,238,429	D284G	probably benign	Het
Pias3	A	G	3: 96,702,218	T319A	possibly damaging	Het
Pik3ip1	A	T	11: 3,333,558	I189F	probably damaging	Het
Pik3r1	T	A	13: 101,689,406	T371S	probably damaging	Het
Prmt7	A	G	8: 106,237,386	D304G	probably benign	Het
Prpf6	T	C	2: 181,652,455	V818A	probably benign	Het
Pstpip2	A	G	18: 77,871,605	E185G	probably damaging	Het
Ptprz1	T	G	6: 22,999,896	F662V	possibly damaging	Het
Rasgrp3	T	C	17: 75,496,416	F70L	probably benign	Het
Rcor1	A	T	12: 111,067,837		probably null	Het
Rnasel	A	G	1: 153,754,560	K274R	probably benign	Het
Rsbn1l	G	A	5: 20,896,457	T695I	probably benign	Het
Rsf1	GGCG	GGCGACGGCCGCG	7: 97,579,906		probably benign	Het
Sema3a	T	C	5: 13,561,820	V351A	probably benign	Het
Serpina12	A	G	12: 104,038,328	L15P	unknown	Het
Siah1a	G	A	8: 86,725,212	R215C	probably benign	Het
Sin3a	T	A	9: 57,103,926	V489D	possibly damaging	Het
Slc22a17	A	G	14: 54,912,118	I208T	probably benign	Het
Slc36a4	G	A	9: 15,734,215	V313M	possibly damaging	Het
Sod1	T	A	16: 90,226,226	L145*	probably null	Het
Svep1	T	C	4: 58,053,260	N3362D	possibly damaging	Het
Telo2	G	T	17: 25,110,821	T239K	probably benign	Het
Trmt11	T	G	10: 30,560,874	D290A	probably damaging	Het
Trpc4	A	T	3: 54,318,095	D955V	possibly damaging	Het
Trpv6	T	C	6: 41,626,167	N257S	probably benign	Het
Usp12	T	C	5: 146,794,620	T15A	probably benign	Het
Vars2	G	T	17: 35,660,780	Q526K	probably damaging	Het
Vipas39	A	G	12: 87,263,903		probably null	Het
Zfp689	A	T	7: 127,444,838	C207S	probably damaging	Het
Zfpl1	C	A	19: 6,084,402	E18*	probably null	Het

Other mutations in Taf4b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01658:Taf4b	APN	18	14844420	missense	probably damaging	1.00
IGL01755:Taf4b	APN	18	14897985	missense	probably benign
IGL01755:Taf4b	APN	18	14897986	missense	probably benign	0.13
IGL02049:Taf4b	APN	18	14830139	missense	probably benign	0.00
IGL02650:Taf4b	APN	18	14841983	nonsense	probably null
IGL03078:Taf4b	APN	18	14813554	missense	possibly damaging	0.48
IGL03169:Taf4b	APN	18	14821535	missense	probably damaging	1.00
IGL03261:Taf4b	APN	18	14821528	missense	probably benign
adirondack	UTSW	18	14804578	missense	probably null	0.16
R0266:Taf4b	UTSW	18	14813077	splice site	probably benign
R0385:Taf4b	UTSW	18	14783760	missense	probably benign	0.00
R1015:Taf4b	UTSW	18	14813098	missense	probably damaging	1.00
R1054:Taf4b	UTSW	18	14821473	missense	probably benign	0.00
R1416:Taf4b	UTSW	18	14821427	splice site	probably benign
R1435:Taf4b	UTSW	18	14807409	missense	probably damaging	1.00
R1609:Taf4b	UTSW	18	14835881	missense	probably damaging	1.00
R1611:Taf4b	UTSW	18	14844469	missense	probably null	1.00
R1906:Taf4b	UTSW	18	14822102	missense	probably benign	0.00
R2038:Taf4b	UTSW	18	14807399	missense	probably damaging	1.00
R2890:Taf4b	UTSW	18	14804792	missense	probably damaging	1.00
R4527:Taf4b	UTSW	18	14821442	missense	probably damaging	1.00
R4559:Taf4b	UTSW	18	14813526	missense	probably damaging	1.00
R4773:Taf4b	UTSW	18	14804520	missense	probably benign	0.30
R4857:Taf4b	UTSW	18	14804578	missense	probably null	0.16
R4946:Taf4b	UTSW	18	14813542	missense	probably damaging	1.00
R4984:Taf4b	UTSW	18	14835816	missense	probably damaging	1.00
R4994:Taf4b	UTSW	18	14898043	missense	probably damaging	0.99
R5010:Taf4b	UTSW	18	14822172	missense	possibly damaging	0.59
R5155:Taf4b	UTSW	18	14830095	missense	probably benign	0.07
R5874:Taf4b	UTSW	18	14804554	missense	probably benign
R6079:Taf4b	UTSW	18	14822198	missense	possibly damaging	0.75
R6303:Taf4b	UTSW	18	14807355	missense	probably damaging	1.00
R6304:Taf4b	UTSW	18	14807355	missense	probably damaging	1.00
R6372:Taf4b	UTSW	18	14804733	missense	probably damaging	1.00
R6972:Taf4b	UTSW	18	14813347	missense	possibly damaging	0.86
R7790:Taf4b	UTSW	18	14813274	missense	probably damaging	1.00
R8021:Taf4b	UTSW	18	14804524	missense	probably damaging	1.00
R8072:Taf4b	UTSW	18	14821528	missense	probably benign
R8075:Taf4b	UTSW	18	14783692	missense	possibly damaging	0.58
R8145:Taf4b	UTSW	18	14830028	missense	probably damaging	1.00
R8221:Taf4b	UTSW	18	14898049	missense	probably damaging	1.00
R8320:Taf4b	UTSW	18	14783692	missense	possibly damaging	0.58
R8509:Taf4b	UTSW	18	14898055	missense	probably damaging	1.00
R8535:Taf4b	UTSW	18	14822138	missense	probably damaging	0.99
R8772:Taf4b	UTSW	18	14835852	missense	probably damaging	1.00
R8805:Taf4b	UTSW	18	14813428	missense	possibly damaging	0.65
R8874:Taf4b	UTSW	18	14830070	missense	probably benign	0.39
R9155:Taf4b	UTSW	18	14813239	missense	probably benign	0.00
R9254:Taf4b	UTSW	18	14813374	missense	probably damaging	0.98
R9338:Taf4b	UTSW	18	14821498	missense	probably benign	0.00
R9379:Taf4b	UTSW	18	14813374	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- TGACACTGCATTCTGTTGCC -3'
(R):5'- AGTATACCGAGTCTTGACAGTTTTC -3'

Sequencing Primer
(F):5'- CTGCTGCAACAGGAGGTAC -3'
(R):5'- TCTGAAGAAATGAAATGGTACTCAC -3'

Posted On

2019-10-17