Mutagenetix > Incidental Mutations

Incidental Mutation 'R4773:Taf4b'

367723

Institutional Source

Beutler Lab

Gene Symbol

Taf4b

Ensembl Gene

ENSMUSG00000054321

Gene Name

TATA-box binding protein associated factor 4b

Synonyms

Taf2c2, TAFII105, 2610524B04Rik, 105kDa, 4932409F03Rik

MMRRC Submission

042411-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.401) question?

Stock #

R4773 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

14783245-14900359 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 14804520 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 217 (T217A)

Ref Sequence

ENSEMBL: ENSMUSP00000126909 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000169862]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000169862
AA Change: T217A

PolyPhen 2 Score 0.300 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000126909
Gene: ENSMUSG00000054321
AA Change: T217A

Domain	Start	End	E-Value	Type
low complexity region	8	23	N/A	INTRINSIC
low complexity region	185	196	N/A	INTRINSIC
Pfam:TAFH	257	348	5.3e-39	PFAM
low complexity region	359	376	N/A	INTRINSIC
low complexity region	412	422	N/A	INTRINSIC
Pfam:TAF4	610	852	4e-72	PFAM

Meta Mutation Damage Score

0.0813

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 96.9%
20x: 94.2%

Validation Efficiency

100% (89/89)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] TATA binding protein (TBP) and TBP-associated factors (TAFs) participate in the formation of the TFIID protein complex, which is involved in initiation of transcription of genes by RNA polymerase II. This gene encodes a cell type-specific TAF that may be responsible for mediating transcription by a subset of activators in B cells. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jun 2014]
PHENOTYPE: Homozygotes for a targeted null mutation are infertile due to a granulosa cell defect preventing normal follicle formation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 82 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931409K22Rik	A	G	5: 24,550,598		probably null	Het
9230009I02Rik	A	G	11: 51,091,262		noncoding transcript	Het
Actl7b	T	C	4: 56,740,972	I129V	probably benign	Het
Adipor2	A	G	6: 119,359,086	L225P	probably benign	Het
Arhgap25	A	G	6: 87,496,071	F35L	probably benign	Het
Asah2	A	T	19: 32,052,858	M138K	probably damaging	Het
Asxl1	T	A	2: 153,401,985	M1486K	probably damaging	Het
B4galt4	T	A	16: 38,752,296	S114R	probably benign	Het
Brpf3	T	G	17: 28,821,259	S885A	probably benign	Het
Cacna1g	G	T	11: 94,411,472	H1944N	possibly damaging	Het
Ccdc110	G	A	8: 45,943,208	C712Y	probably damaging	Het
Ccdc175	A	T	12: 72,136,048	I399N	probably damaging	Het
Cct8l1	A	T	5: 25,517,756	T490S	probably benign	Het
Cd109	CATTTATTTATTTATTTATTTATTTATTTATTTAT	CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT	9: 78,712,500		probably benign	Het
Copa	A	G	1: 172,105,220	N371D	probably damaging	Het
Cpeb1	A	T	7: 81,355,947	H381Q	probably benign	Het
Cyp2d40	T	A	15: 82,761,562	I81F	possibly damaging	Het
Dscc1	A	T	15: 55,080,258	D405E	probably benign	Het
Ece1	A	G	4: 137,945,153	D369G	probably benign	Het
Exd2	T	C	12: 80,475,818	V17A	possibly damaging	Het
Fam111a	A	T	19: 12,588,408	N507I	possibly damaging	Het
Flnc	T	C	6: 29,445,039	V719A	possibly damaging	Het
Fscb	C	T	12: 64,473,690	G334D	probably damaging	Het
Glud1	T	C	14: 34,321,825		probably null	Het
Gm8126	T	A	14: 43,261,615	Y180*	probably null	Het
Grip2	G	A	6: 91,782,432	P347L	possibly damaging	Het
H60b	C	T	10: 22,288,745		probably benign	Het
Hist1h1d	T	C	13: 23,555,402	S105P	probably damaging	Het
Itga6	T	C	2: 71,822,444	V217A	probably benign	Het
Kndc1	G	A	7: 139,924,031	W1083*	probably null	Het
Limch1	A	T	5: 67,027,507	D613V	probably damaging	Het
Lpl	T	A	8: 68,896,751	C310S	probably damaging	Het
March1	T	A	8: 66,387,224	C220S	probably benign	Het
Mbd5	A	C	2: 49,274,611	H308P	probably damaging	Het
Med13	T	C	11: 86,276,920	D2003G	probably damaging	Het
Mettl16	T	A	11: 74,817,301	V442D	possibly damaging	Het
Mstn	A	T	1: 53,062,108	T115S	probably benign	Het
Nfil3	A	G	13: 52,968,014	S285P	probably damaging	Het
Olfr218	A	C	1: 173,204,229	Y291S	probably damaging	Het
Olfr645	A	G	7: 104,084,295	S262P	probably damaging	Het
Otof	A	G	5: 30,394,682	V321A	probably benign	Het
Pcdha8	G	T	18: 36,994,573	A703S	probably damaging	Het
Pcdhb18	A	G	18: 37,490,454	Y279C	probably damaging	Het
Pdgfa	T	C	5: 138,993,296	D51G	probably benign	Het
Pdzd8	A	G	19: 59,300,860	Y703H	probably damaging	Het
Pecr	G	T	1: 72,267,435	P229Q	probably damaging	Het
Phkg1	G	T	5: 129,873,273		probably null	Het
Plxnb2	A	T	15: 89,166,947	H356Q	probably benign	Het
Polr1b	T	C	2: 129,105,328	I191T	probably benign	Het
Ppp4r3a	A	G	12: 101,082,767	L35P	possibly damaging	Het
Rasa2	C	T	9: 96,544,417	G792D	probably benign	Het
Rps11-ps4	T	C	12: 51,297,623		noncoding transcript	Het
Sema3g	A	G	14: 31,220,709	D89G	probably benign	Het
Shroom3	G	T	5: 92,943,086	V1151F	probably damaging	Het
Slfn8	A	G	11: 83,017,393	V108A	probably damaging	Het
Smg9	T	A	7: 24,407,594	M221K	possibly damaging	Het
Soga1	G	T	2: 157,030,569	Q953K	probably benign	Het
Sos1	A	G	17: 80,398,231	S1304P	probably damaging	Het
Spert	T	A	14: 75,583,106	Y393F	probably damaging	Het
Sqle	C	A	15: 59,317,839	A110E	possibly damaging	Het
Stab2	G	A	10: 86,907,371	Q1154*	probably null	Het
Tex15	T	C	8: 33,582,732	V2769A	probably benign	Het
Tmem156	A	T	5: 65,080,159	C53S	probably damaging	Het
Tmtc3	T	A	10: 100,457,139	K452N	possibly damaging	Het
Tns2	C	T	15: 102,108,934	R281C	probably damaging	Het
Tph1	T	C	7: 46,656,952	E195G	probably damaging	Het
Trpc6	T	A	9: 8,609,851	Y107N	possibly damaging	Het
Tsga10	G	A	1: 37,835,525	T93I	probably damaging	Het
Ttc25	C	A	11: 100,549,916	N74K	probably benign	Het
Ttn	T	A	2: 76,741,434	N26372Y	probably damaging	Het
Tubd1	T	C	11: 86,555,302	L256P	possibly damaging	Het
Txnrd2	C	G	16: 18,440,819	A126G	probably benign	Het
Vmn1r210	T	G	13: 22,827,204	K304T	probably benign	Het
Vps25	T	C	11: 101,258,829	S160P	probably benign	Het
Vrk3	T	A	7: 44,775,476	D438E	probably benign	Het
Vwa5b1	A	G	4: 138,581,755	L708P	probably benign	Het
Washc3	C	T	10: 88,219,262	Q105*	probably null	Het
Wdr83os	T	A	8: 85,080,781		probably benign	Het
Wwc1	T	C	11: 35,867,296	H741R	probably benign	Het
Zan	T	C	5: 137,436,313		probably benign	Het
Zdhhc4	A	T	5: 143,326,176	L14I	possibly damaging	Het
Zfp568	T	A	7: 29,997,770	D38E	probably damaging	Het

Other mutations in Taf4b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01658:Taf4b	APN	18	14844420	missense	probably damaging	1.00
IGL01755:Taf4b	APN	18	14897985	missense	probably benign
IGL01755:Taf4b	APN	18	14897986	missense	probably benign	0.13
IGL02049:Taf4b	APN	18	14830139	missense	probably benign	0.00
IGL02650:Taf4b	APN	18	14841983	nonsense	probably null
IGL03078:Taf4b	APN	18	14813554	missense	possibly damaging	0.48
IGL03169:Taf4b	APN	18	14821535	missense	probably damaging	1.00
IGL03261:Taf4b	APN	18	14821528	missense	probably benign
adirondack	UTSW	18	14804578	missense	probably null	0.16
R0266:Taf4b	UTSW	18	14813077	splice site	probably benign
R0385:Taf4b	UTSW	18	14783760	missense	probably benign	0.00
R1015:Taf4b	UTSW	18	14813098	missense	probably damaging	1.00
R1054:Taf4b	UTSW	18	14821473	missense	probably benign	0.00
R1416:Taf4b	UTSW	18	14821427	splice site	probably benign
R1435:Taf4b	UTSW	18	14807409	missense	probably damaging	1.00
R1609:Taf4b	UTSW	18	14835881	missense	probably damaging	1.00
R1611:Taf4b	UTSW	18	14844469	missense	probably null	1.00
R1906:Taf4b	UTSW	18	14822102	missense	probably benign	0.00
R2038:Taf4b	UTSW	18	14807399	missense	probably damaging	1.00
R2890:Taf4b	UTSW	18	14804792	missense	probably damaging	1.00
R4527:Taf4b	UTSW	18	14821442	missense	probably damaging	1.00
R4559:Taf4b	UTSW	18	14813526	missense	probably damaging	1.00
R4857:Taf4b	UTSW	18	14804578	missense	probably null	0.16
R4946:Taf4b	UTSW	18	14813542	missense	probably damaging	1.00
R4984:Taf4b	UTSW	18	14835816	missense	probably damaging	1.00
R4994:Taf4b	UTSW	18	14898043	missense	probably damaging	0.99
R5010:Taf4b	UTSW	18	14822172	missense	possibly damaging	0.59
R5155:Taf4b	UTSW	18	14830095	missense	probably benign	0.07
R5874:Taf4b	UTSW	18	14804554	missense	probably benign
R6079:Taf4b	UTSW	18	14822198	missense	possibly damaging	0.75
R6303:Taf4b	UTSW	18	14807355	missense	probably damaging	1.00
R6304:Taf4b	UTSW	18	14807355	missense	probably damaging	1.00
R6372:Taf4b	UTSW	18	14804733	missense	probably damaging	1.00
R6972:Taf4b	UTSW	18	14813347	missense	possibly damaging	0.86
R7538:Taf4b	UTSW	18	14813545	missense	probably damaging	1.00
R7790:Taf4b	UTSW	18	14813274	missense	probably damaging	1.00
R8021:Taf4b	UTSW	18	14804524	missense	probably damaging	1.00
R8072:Taf4b	UTSW	18	14821528	missense	probably benign
R8075:Taf4b	UTSW	18	14783692	missense	possibly damaging	0.58
R8145:Taf4b	UTSW	18	14830028	missense	probably damaging	1.00
R8221:Taf4b	UTSW	18	14898049	missense	probably damaging	1.00
R8320:Taf4b	UTSW	18	14783692	missense	possibly damaging	0.58
R8509:Taf4b	UTSW	18	14898055	missense	probably damaging	1.00
R8535:Taf4b	UTSW	18	14822138	missense	probably damaging	0.99
R8772:Taf4b	UTSW	18	14835852	missense	probably damaging	1.00
R8805:Taf4b	UTSW	18	14813428	missense	possibly damaging	0.65
R8874:Taf4b	UTSW	18	14830070	missense	probably benign	0.39
R9155:Taf4b	UTSW	18	14813239	missense	probably benign	0.00
R9254:Taf4b	UTSW	18	14813374	missense	probably damaging	0.98
R9338:Taf4b	UTSW	18	14821498	missense	probably benign	0.00
R9379:Taf4b	UTSW	18	14813374	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- TTACTTGAAAGCAGAGATGCCAG -3'
(R):5'- GAGACTGTGATCCACTACATGC -3'

Sequencing Primer
(F):5'- GCCAGAATTCATTTGGAGCC -3'
(R):5'- TTCACATTTTCTAGCACTGTCTG -3'

Posted On

2015-12-29