Incidental Mutation 'R9772:Son'
ID 733499
Institutional Source Beutler Lab
Gene Symbol Son
Ensembl Gene ENSMUSG00000022961
Gene Name Son DNA binding protein
Synonyms 2900011L12Rik
MMRRC Submission
Accession Numbers
Essential gene? Probably essential (E-score: 0.955) question?
Stock # R9772 (G1)
Quality Score 101.592
Status Not validated
Chromosome 16
Chromosomal Location 91444712-91476080 bp(+) (GRCm39)
Type of Mutation small deletion (7 aa in frame mutation)
DNA Base Change (assembly) AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG to AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG at 91457222 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000114036] [ENSMUST00000114037] [ENSMUST00000117633] [ENSMUST00000119368] [ENSMUST00000122302] [ENSMUST00000140312]
AlphaFold Q9QX47
Predicted Effect probably benign
Transcript: ENSMUST00000114036
SMART Domains Protein: ENSMUSP00000109670
Gene: ENSMUSG00000022961

DomainStartEndE-ValueType
coiled coil region 106 132 N/A INTRINSIC
internal_repeat_1 155 350 1.65e-7 PROSPERO
internal_repeat_2 214 362 6.55e-6 PROSPERO
low complexity region 391 403 N/A INTRINSIC
low complexity region 459 469 N/A INTRINSIC
internal_repeat_1 507 750 1.65e-7 PROSPERO
low complexity region 975 1021 N/A INTRINSIC
low complexity region 1124 1135 N/A INTRINSIC
low complexity region 1141 1172 N/A INTRINSIC
internal_repeat_2 1208 1347 6.55e-6 PROSPERO
low complexity region 1354 1376 N/A INTRINSIC
low complexity region 1386 1407 N/A INTRINSIC
low complexity region 1805 1811 N/A INTRINSIC
low complexity region 1838 2067 N/A INTRINSIC
low complexity region 2080 2091 N/A INTRINSIC
low complexity region 2094 2105 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114037
SMART Domains Protein: ENSMUSP00000109671
Gene: ENSMUSG00000022961

DomainStartEndE-ValueType
coiled coil region 106 132 N/A INTRINSIC
internal_repeat_1 155 350 1.71e-7 PROSPERO
internal_repeat_2 214 362 7.05e-6 PROSPERO
low complexity region 391 403 N/A INTRINSIC
low complexity region 459 469 N/A INTRINSIC
internal_repeat_1 507 750 1.71e-7 PROSPERO
low complexity region 975 1021 N/A INTRINSIC
low complexity region 1124 1135 N/A INTRINSIC
low complexity region 1141 1172 N/A INTRINSIC
internal_repeat_2 1208 1347 7.05e-6 PROSPERO
low complexity region 1354 1376 N/A INTRINSIC
low complexity region 1386 1407 N/A INTRINSIC
low complexity region 1805 1811 N/A INTRINSIC
low complexity region 1838 2067 N/A INTRINSIC
low complexity region 2080 2091 N/A INTRINSIC
low complexity region 2094 2105 N/A INTRINSIC
low complexity region 2149 2155 N/A INTRINSIC
G_patch 2321 2367 1.15e-17 SMART
Pfam:DND1_DSRM 2388 2442 5.7e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000117633
SMART Domains Protein: ENSMUSP00000112453
Gene: ENSMUSG00000022961

DomainStartEndE-ValueType
coiled coil region 106 132 N/A INTRINSIC
internal_repeat_1 155 350 1.59e-7 PROSPERO
internal_repeat_2 214 362 6.63e-6 PROSPERO
low complexity region 391 403 N/A INTRINSIC
low complexity region 459 469 N/A INTRINSIC
internal_repeat_1 507 750 1.59e-7 PROSPERO
low complexity region 975 1021 N/A INTRINSIC
low complexity region 1124 1135 N/A INTRINSIC
low complexity region 1141 1172 N/A INTRINSIC
internal_repeat_2 1208 1347 6.63e-6 PROSPERO
low complexity region 1354 1376 N/A INTRINSIC
low complexity region 1386 1407 N/A INTRINSIC
low complexity region 1805 1811 N/A INTRINSIC
Pfam:RSRP 1909 2216 1e-12 PFAM
G_patch 2321 2367 1.15e-17 SMART
DSRM 2390 2458 5.37e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000119368
SMART Domains Protein: ENSMUSP00000113129
Gene: ENSMUSG00000022961

DomainStartEndE-ValueType
coiled coil region 106 132 N/A INTRINSIC
internal_repeat_1 155 350 2.22e-7 PROSPERO
internal_repeat_2 214 362 8.67e-6 PROSPERO
low complexity region 391 403 N/A INTRINSIC
low complexity region 459 469 N/A INTRINSIC
internal_repeat_1 507 750 2.22e-7 PROSPERO
low complexity region 975 1021 N/A INTRINSIC
low complexity region 1124 1135 N/A INTRINSIC
low complexity region 1141 1172 N/A INTRINSIC
internal_repeat_2 1208 1347 8.67e-6 PROSPERO
low complexity region 1354 1376 N/A INTRINSIC
low complexity region 1386 1407 N/A INTRINSIC
low complexity region 1805 1811 N/A INTRINSIC
low complexity region 1838 2067 N/A INTRINSIC
low complexity region 2080 2091 N/A INTRINSIC
low complexity region 2094 2105 N/A INTRINSIC
low complexity region 2149 2155 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000122302
SMART Domains Protein: ENSMUSP00000113615
Gene: ENSMUSG00000022961

DomainStartEndE-ValueType
low complexity region 90 101 N/A INTRINSIC
low complexity region 104 115 N/A INTRINSIC
low complexity region 159 165 N/A INTRINSIC
G_patch 331 377 1.15e-17 SMART
Pfam:DND1_DSRM 398 452 7.9e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000140312
SMART Domains Protein: ENSMUSP00000122320
Gene: ENSMUSG00000022961

DomainStartEndE-ValueType
coiled coil region 106 132 N/A INTRINSIC
internal_repeat_1 155 350 2.93e-7 PROSPERO
internal_repeat_2 214 362 1.1e-5 PROSPERO
low complexity region 391 403 N/A INTRINSIC
low complexity region 459 469 N/A INTRINSIC
internal_repeat_1 507 750 2.93e-7 PROSPERO
low complexity region 975 1021 N/A INTRINSIC
low complexity region 1124 1135 N/A INTRINSIC
low complexity region 1141 1172 N/A INTRINSIC
internal_repeat_2 1208 1347 1.1e-5 PROSPERO
low complexity region 1354 1376 N/A INTRINSIC
low complexity region 1386 1407 N/A INTRINSIC
low complexity region 1805 1811 N/A INTRINSIC
low complexity region 1838 2067 N/A INTRINSIC
low complexity region 2080 2091 N/A INTRINSIC
low complexity region 2094 2105 N/A INTRINSIC
low complexity region 2149 2155 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000147891
SMART Domains Protein: ENSMUSP00000122544
Gene: ENSMUSG00000022961

DomainStartEndE-ValueType
Pfam:RSRP 61 358 2.9e-13 PFAM
low complexity region 466 477 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.4%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that contains multiple simple repeats. The encoded protein binds RNA and promotes pre-mRNA splicing, particularly of transcripts with poor splice sites. The protein also recognizes a specific DNA sequence found in the human hepatitis B virus (HBV) and represses HBV core promoter activity. There is a pseudogene for this gene on chromosome 1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl2 A T 2: 26,985,666 (GRCm39) I517F probably benign Het
Ankdd1a A G 9: 65,408,749 (GRCm39) C506R probably damaging Het
Arid3c T C 4: 41,724,723 (GRCm39) N371D probably damaging Het
Ccdc117 C T 11: 5,492,042 (GRCm39) R6Q possibly damaging Het
Ccdc78 C T 17: 26,005,665 (GRCm39) R26* probably null Het
Clca4a C A 3: 144,676,422 (GRCm39) W86L probably damaging Het
Clrn2 C T 5: 45,611,369 (GRCm39) Q73* probably null Het
Cpne6 A G 14: 55,754,117 (GRCm39) D478G probably benign Het
Cyp2c40 T A 19: 39,792,348 (GRCm39) I199L probably benign Het
Dna2 T C 10: 62,786,522 (GRCm39) V90A probably benign Het
Dydc1 A G 14: 40,804,248 (GRCm39) E90G probably damaging Het
Egf A T 3: 129,499,756 (GRCm39) S795T probably benign Het
Gm13090 G T 4: 151,175,565 (GRCm39) A102S unknown Het
Hectd4 A T 5: 121,448,744 (GRCm39) Y364F probably benign Het
Iqgap3 C A 3: 88,016,176 (GRCm39) F986L probably damaging Het
Krt79 T G 15: 101,839,196 (GRCm39) E424D probably benign Het
Ltf T C 9: 110,869,425 (GRCm39) S87P unknown Het
Mesp2 A G 7: 79,461,348 (GRCm39) I224M possibly damaging Het
Mettl25 T C 10: 105,633,127 (GRCm39) R439G probably benign Het
Mettl27 C T 5: 134,962,390 (GRCm39) R63W possibly damaging Het
Nap1l1 C T 10: 111,325,911 (GRCm39) R77* probably null Het
Niban2 T C 2: 32,795,868 (GRCm39) I48T probably damaging Het
Notch4 G T 17: 34,792,883 (GRCm39) probably null Het
Npepps A G 11: 97,113,983 (GRCm39) I631T probably benign Het
Or4c105 G A 2: 88,647,958 (GRCm39) V148I probably benign Het
Or8b51 A T 9: 38,568,964 (GRCm39) C241* probably null Het
Pacsin3 T A 2: 91,093,138 (GRCm39) L210Q probably damaging Het
Ppp2r1a A T 17: 21,181,855 (GRCm39) I458F probably damaging Het
Ryr2 T C 13: 11,609,785 (GRCm39) E4347G probably benign Het
Ryr3 A G 2: 112,657,048 (GRCm39) I1911T probably damaging Het
Sec16a A G 2: 26,329,417 (GRCm39) I866T possibly damaging Het
Sfr1 G T 19: 47,722,019 (GRCm39) C145F probably benign Het
Slc35f4 A T 14: 49,551,175 (GRCm39) Y230N probably damaging Het
Slx4 A G 16: 3,818,849 (GRCm39) V89A Het
Tbc1d23 A G 16: 56,990,765 (GRCm39) I671T probably damaging Het
Trub1 G A 19: 57,472,075 (GRCm39) V184I probably benign Het
Usp10 CAA CAAA 8: 120,658,620 (GRCm39) probably null Het
Vit A C 17: 78,932,398 (GRCm39) T502P probably damaging Het
Vmn2r15 C T 5: 109,434,923 (GRCm39) G594R probably damaging Het
Other mutations in Son
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00531:Son APN 16 91,461,210 (GRCm39) missense probably damaging 0.99
IGL01024:Son APN 16 91,452,798 (GRCm39) missense probably damaging 1.00
IGL01066:Son APN 16 91,457,024 (GRCm39) intron probably benign
IGL01083:Son APN 16 91,454,279 (GRCm39) missense probably damaging 1.00
IGL01115:Son APN 16 91,456,346 (GRCm39) missense probably benign 0.31
IGL01467:Son APN 16 91,454,165 (GRCm39) missense possibly damaging 0.93
IGL01506:Son APN 16 91,454,174 (GRCm39) missense possibly damaging 0.67
IGL01933:Son APN 16 91,454,903 (GRCm39) missense probably benign 0.00
IGL02156:Son APN 16 91,452,992 (GRCm39) missense possibly damaging 0.93
IGL02473:Son APN 16 91,455,683 (GRCm39) missense probably damaging 0.99
IGL02498:Son APN 16 91,453,713 (GRCm39) missense probably damaging 0.99
IGL02517:Son APN 16 91,452,099 (GRCm39) missense possibly damaging 0.92
IGL02530:Son APN 16 91,455,359 (GRCm39) missense possibly damaging 0.50
IGL02865:Son APN 16 91,448,640 (GRCm39) missense probably damaging 1.00
IGL03180:Son APN 16 91,453,896 (GRCm39) missense probably damaging 1.00
R0013:Son UTSW 16 91,448,550 (GRCm39) missense probably damaging 1.00
R0036:Son UTSW 16 91,457,054 (GRCm39) intron probably benign
R0037:Son UTSW 16 91,461,616 (GRCm39) missense probably damaging 1.00
R0041:Son UTSW 16 91,456,221 (GRCm39) missense probably damaging 1.00
R0048:Son UTSW 16 91,455,865 (GRCm39) missense possibly damaging 0.94
R0048:Son UTSW 16 91,455,865 (GRCm39) missense possibly damaging 0.94
R0056:Son UTSW 16 91,475,043 (GRCm39) missense possibly damaging 0.86
R0227:Son UTSW 16 91,453,761 (GRCm39) missense probably damaging 0.99
R0256:Son UTSW 16 91,453,472 (GRCm39) missense possibly damaging 0.95
R0302:Son UTSW 16 91,453,032 (GRCm39) missense probably damaging 1.00
R0815:Son UTSW 16 91,452,372 (GRCm39) missense probably damaging 0.98
R1225:Son UTSW 16 91,454,228 (GRCm39) missense probably damaging 1.00
R1255:Son UTSW 16 91,461,583 (GRCm39) missense probably damaging 1.00
R1457:Son UTSW 16 91,453,974 (GRCm39) missense probably damaging 1.00
R1459:Son UTSW 16 91,452,230 (GRCm39) missense possibly damaging 0.93
R1535:Son UTSW 16 91,456,622 (GRCm39) missense probably damaging 0.99
R1587:Son UTSW 16 91,456,606 (GRCm39) missense probably damaging 1.00
R1605:Son UTSW 16 91,454,552 (GRCm39) missense probably damaging 1.00
R1629:Son UTSW 16 91,454,510 (GRCm39) missense probably damaging 1.00
R1711:Son UTSW 16 91,457,114 (GRCm39) intron probably benign
R2138:Son UTSW 16 91,456,260 (GRCm39) missense possibly damaging 0.95
R2245:Son UTSW 16 91,444,848 (GRCm39) splice site probably null
R2351:Son UTSW 16 91,454,547 (GRCm39) missense probably damaging 0.98
R2434:Son UTSW 16 91,451,575 (GRCm39) missense probably damaging 1.00
R2870:Son UTSW 16 91,461,205 (GRCm39) splice site probably null
R2871:Son UTSW 16 91,461,205 (GRCm39) splice site probably null
R2872:Son UTSW 16 91,461,205 (GRCm39) splice site probably null
R2889:Son UTSW 16 91,456,787 (GRCm39) unclassified probably benign
R3712:Son UTSW 16 91,453,614 (GRCm39) missense probably damaging 0.99
R3913:Son UTSW 16 91,456,999 (GRCm39) intron probably benign
R4172:Son UTSW 16 91,456,250 (GRCm39) missense probably damaging 1.00
R4301:Son UTSW 16 91,455,299 (GRCm39) missense possibly damaging 0.53
R4302:Son UTSW 16 91,455,299 (GRCm39) missense possibly damaging 0.53
R4770:Son UTSW 16 91,455,756 (GRCm39) missense probably damaging 0.96
R4881:Son UTSW 16 91,472,397 (GRCm39) missense probably benign 0.31
R5020:Son UTSW 16 91,453,263 (GRCm39) missense probably damaging 1.00
R5032:Son UTSW 16 91,454,552 (GRCm39) missense probably damaging 1.00
R5151:Son UTSW 16 91,452,587 (GRCm39) missense probably damaging 1.00
R5153:Son UTSW 16 91,451,910 (GRCm39) missense possibly damaging 0.86
R5215:Son UTSW 16 91,453,563 (GRCm39) missense probably damaging 0.99
R5243:Son UTSW 16 91,451,621 (GRCm39) missense probably damaging 1.00
R5354:Son UTSW 16 91,452,627 (GRCm39) missense probably damaging 0.99
R5529:Son UTSW 16 91,452,354 (GRCm39) missense probably damaging 1.00
R5696:Son UTSW 16 91,468,301 (GRCm39) missense possibly damaging 0.67
R5763:Son UTSW 16 91,454,378 (GRCm39) missense probably damaging 1.00
R5766:Son UTSW 16 91,461,875 (GRCm39) intron probably benign
R5788:Son UTSW 16 91,456,940 (GRCm39) intron probably benign
R5992:Son UTSW 16 91,455,792 (GRCm39) missense probably benign 0.04
R6314:Son UTSW 16 91,457,298 (GRCm39) intron probably benign
R6371:Son UTSW 16 91,471,629 (GRCm39)
R6429:Son UTSW 16 91,455,054 (GRCm39) missense probably benign 0.33
R6451:Son UTSW 16 91,454,490 (GRCm39) missense probably damaging 0.99
R6489:Son UTSW 16 91,452,044 (GRCm39) missense possibly damaging 0.70
R6513:Son UTSW 16 91,456,835 (GRCm39) intron probably benign
R6753:Son UTSW 16 91,454,076 (GRCm39) missense probably damaging 0.99
R6916:Son UTSW 16 91,451,673 (GRCm39) missense probably damaging 0.97
R7070:Son UTSW 16 91,453,729 (GRCm39) unclassified probably benign
R7079:Son UTSW 16 91,453,729 (GRCm39) unclassified probably benign
R7110:Son UTSW 16 91,453,406 (GRCm39) missense probably benign 0.01
R7120:Son UTSW 16 91,467,414 (GRCm39) missense unknown
R7120:Son UTSW 16 91,453,579 (GRCm39) unclassified probably benign
R7167:Son UTSW 16 91,457,222 (GRCm39) small deletion probably benign
R7205:Son UTSW 16 91,457,183 (GRCm39) small deletion probably benign
R7208:Son UTSW 16 91,458,990 (GRCm39) missense unknown
R7219:Son UTSW 16 91,461,889 (GRCm39) missense unknown
R7249:Son UTSW 16 91,457,222 (GRCm39) small deletion probably benign
R7328:Son UTSW 16 91,455,278 (GRCm39) missense probably benign 0.33
R7330:Son UTSW 16 91,453,486 (GRCm39) unclassified probably benign
R7374:Son UTSW 16 91,457,222 (GRCm39) small deletion probably benign
R7405:Son UTSW 16 91,453,579 (GRCm39) unclassified probably benign
R7420:Son UTSW 16 91,457,222 (GRCm39) small deletion probably benign
R7424:Son UTSW 16 91,457,222 (GRCm39) small deletion probably benign
R7464:Son UTSW 16 91,453,579 (GRCm39) unclassified probably benign
R7514:Son UTSW 16 91,451,748 (GRCm39) missense probably damaging 0.99
R7555:Son UTSW 16 91,455,810 (GRCm39) missense probably damaging 0.99
R7645:Son UTSW 16 91,457,183 (GRCm39) small deletion probably benign
R7716:Son UTSW 16 91,453,579 (GRCm39) unclassified probably benign
R7718:Son UTSW 16 91,457,222 (GRCm39) small deletion probably benign
R7778:Son UTSW 16 91,453,416 (GRCm39) missense probably damaging 0.99
R7824:Son UTSW 16 91,453,416 (GRCm39) missense probably damaging 0.99
R7856:Son UTSW 16 91,456,146 (GRCm39) missense probably damaging 0.99
R7870:Son UTSW 16 91,453,486 (GRCm39) unclassified probably benign
R7928:Son UTSW 16 91,453,729 (GRCm39) unclassified probably benign
R7972:Son UTSW 16 91,457,222 (GRCm39) small deletion probably benign
R7978:Son UTSW 16 91,457,222 (GRCm39) small deletion probably benign
R8000:Son UTSW 16 91,457,222 (GRCm39) small deletion probably benign
R8192:Son UTSW 16 91,452,437 (GRCm39) missense possibly damaging 0.91
R8221:Son UTSW 16 91,453,734 (GRCm39) missense probably damaging 1.00
R8227:Son UTSW 16 91,453,579 (GRCm39) unclassified probably benign
R8233:Son UTSW 16 91,457,222 (GRCm39) small deletion probably benign
R8255:Son UTSW 16 91,461,824 (GRCm39) missense unknown
R8292:Son UTSW 16 91,453,545 (GRCm39) missense possibly damaging 0.93
R8407:Son UTSW 16 91,457,222 (GRCm39) small deletion probably benign
R8468:Son UTSW 16 91,453,579 (GRCm39) unclassified probably benign
R8495:Son UTSW 16 91,457,183 (GRCm39) small deletion probably benign
R8772:Son UTSW 16 91,454,826 (GRCm39) missense possibly damaging 0.65
R8796:Son UTSW 16 91,457,222 (GRCm39) small deletion probably benign
R8862:Son UTSW 16 91,453,734 (GRCm39) missense probably damaging 1.00
R8962:Son UTSW 16 91,455,057 (GRCm39) missense possibly damaging 0.91
R8972:Son UTSW 16 91,457,222 (GRCm39) small deletion probably benign
R8991:Son UTSW 16 91,453,608 (GRCm39) missense possibly damaging 0.95
R8991:Son UTSW 16 91,453,366 (GRCm39) missense probably benign 0.04
R9086:Son UTSW 16 91,467,418 (GRCm39) missense unknown
R9138:Son UTSW 16 91,452,006 (GRCm39) missense possibly damaging 0.80
R9232:Son UTSW 16 91,453,579 (GRCm39) unclassified probably benign
R9241:Son UTSW 16 91,454,122 (GRCm39) missense probably damaging 0.96
R9258:Son UTSW 16 91,474,570 (GRCm39) missense unknown
R9328:Son UTSW 16 91,452,645 (GRCm39) missense possibly damaging 0.67
R9420:Son UTSW 16 91,454,508 (GRCm39) missense probably damaging 0.98
R9468:Son UTSW 16 91,454,439 (GRCm39) missense possibly damaging 0.53
R9500:Son UTSW 16 91,457,222 (GRCm39) small deletion probably benign
R9516:Son UTSW 16 91,453,579 (GRCm39) unclassified probably benign
R9595:Son UTSW 16 91,454,241 (GRCm39) missense possibly damaging 0.73
R9679:Son UTSW 16 91,457,222 (GRCm39) small deletion probably benign
R9719:Son UTSW 16 91,456,440 (GRCm39) missense probably damaging 0.96
R9749:Son UTSW 16 91,453,579 (GRCm39) unclassified probably benign
R9782:Son UTSW 16 91,444,838 (GRCm39) missense probably damaging 0.99
R9788:Son UTSW 16 91,453,699 (GRCm39) unclassified probably benign
RF007:Son UTSW 16 91,456,257 (GRCm39) missense possibly damaging 0.53
RF041:Son UTSW 16 91,453,579 (GRCm39) unclassified probably benign
Z1176:Son UTSW 16 91,452,689 (GRCm39) missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- GCATAGATCCAAGTCCAGGG -3'
(R):5'- TTTCCGCCGAATGGGAGATC -3'

Sequencing Primer
(F):5'- CATAGATCCAAGTCCAGGGAAAGG -3'
(R):5'- CGAATGGGAGATCTACTAAACCTTC -3'
Posted On 2022-11-14