Incidental Mutation 'R6753:Son'
ID530929
Institutional Source Beutler Lab
Gene Symbol Son
Ensembl Gene ENSMUSG00000022961
Gene NameSon DNA binding protein
Synonyms2900011L12Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.961) question?
Stock #R6753 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location91647506-91679221 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 91657188 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 941 (Q941R)
Ref Sequence ENSEMBL: ENSMUSP00000122320 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114036] [ENSMUST00000114037] [ENSMUST00000117633] [ENSMUST00000119368] [ENSMUST00000122302] [ENSMUST00000140312]
Predicted Effect possibly damaging
Transcript: ENSMUST00000114036
AA Change: Q941R

PolyPhen 2 Score 0.719 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000109670
Gene: ENSMUSG00000022961
AA Change: Q941R

DomainStartEndE-ValueType
coiled coil region 106 132 N/A INTRINSIC
internal_repeat_1 155 350 1.65e-7 PROSPERO
internal_repeat_2 214 362 6.55e-6 PROSPERO
low complexity region 391 403 N/A INTRINSIC
low complexity region 459 469 N/A INTRINSIC
internal_repeat_1 507 750 1.65e-7 PROSPERO
low complexity region 975 1021 N/A INTRINSIC
low complexity region 1124 1135 N/A INTRINSIC
low complexity region 1141 1172 N/A INTRINSIC
internal_repeat_2 1208 1347 6.55e-6 PROSPERO
low complexity region 1354 1376 N/A INTRINSIC
low complexity region 1386 1407 N/A INTRINSIC
low complexity region 1805 1811 N/A INTRINSIC
low complexity region 1838 2067 N/A INTRINSIC
low complexity region 2080 2091 N/A INTRINSIC
low complexity region 2094 2105 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000114037
AA Change: Q941R

PolyPhen 2 Score 0.719 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000109671
Gene: ENSMUSG00000022961
AA Change: Q941R

DomainStartEndE-ValueType
coiled coil region 106 132 N/A INTRINSIC
internal_repeat_1 155 350 1.71e-7 PROSPERO
internal_repeat_2 214 362 7.05e-6 PROSPERO
low complexity region 391 403 N/A INTRINSIC
low complexity region 459 469 N/A INTRINSIC
internal_repeat_1 507 750 1.71e-7 PROSPERO
low complexity region 975 1021 N/A INTRINSIC
low complexity region 1124 1135 N/A INTRINSIC
low complexity region 1141 1172 N/A INTRINSIC
internal_repeat_2 1208 1347 7.05e-6 PROSPERO
low complexity region 1354 1376 N/A INTRINSIC
low complexity region 1386 1407 N/A INTRINSIC
low complexity region 1805 1811 N/A INTRINSIC
low complexity region 1838 2067 N/A INTRINSIC
low complexity region 2080 2091 N/A INTRINSIC
low complexity region 2094 2105 N/A INTRINSIC
low complexity region 2149 2155 N/A INTRINSIC
G_patch 2321 2367 1.15e-17 SMART
Pfam:DND1_DSRM 2388 2442 5.7e-15 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000117633
AA Change: Q941R

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000112453
Gene: ENSMUSG00000022961
AA Change: Q941R

DomainStartEndE-ValueType
coiled coil region 106 132 N/A INTRINSIC
internal_repeat_1 155 350 1.59e-7 PROSPERO
internal_repeat_2 214 362 6.63e-6 PROSPERO
low complexity region 391 403 N/A INTRINSIC
low complexity region 459 469 N/A INTRINSIC
internal_repeat_1 507 750 1.59e-7 PROSPERO
low complexity region 975 1021 N/A INTRINSIC
low complexity region 1124 1135 N/A INTRINSIC
low complexity region 1141 1172 N/A INTRINSIC
internal_repeat_2 1208 1347 6.63e-6 PROSPERO
low complexity region 1354 1376 N/A INTRINSIC
low complexity region 1386 1407 N/A INTRINSIC
low complexity region 1805 1811 N/A INTRINSIC
Pfam:RSRP 1909 2216 1e-12 PFAM
G_patch 2321 2367 1.15e-17 SMART
DSRM 2390 2458 5.37e-20 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000119368
AA Change: Q941R

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000113129
Gene: ENSMUSG00000022961
AA Change: Q941R

DomainStartEndE-ValueType
coiled coil region 106 132 N/A INTRINSIC
internal_repeat_1 155 350 2.22e-7 PROSPERO
internal_repeat_2 214 362 8.67e-6 PROSPERO
low complexity region 391 403 N/A INTRINSIC
low complexity region 459 469 N/A INTRINSIC
internal_repeat_1 507 750 2.22e-7 PROSPERO
low complexity region 975 1021 N/A INTRINSIC
low complexity region 1124 1135 N/A INTRINSIC
low complexity region 1141 1172 N/A INTRINSIC
internal_repeat_2 1208 1347 8.67e-6 PROSPERO
low complexity region 1354 1376 N/A INTRINSIC
low complexity region 1386 1407 N/A INTRINSIC
low complexity region 1805 1811 N/A INTRINSIC
low complexity region 1838 2067 N/A INTRINSIC
low complexity region 2080 2091 N/A INTRINSIC
low complexity region 2094 2105 N/A INTRINSIC
low complexity region 2149 2155 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000122302
SMART Domains Protein: ENSMUSP00000113615
Gene: ENSMUSG00000022961

DomainStartEndE-ValueType
low complexity region 90 101 N/A INTRINSIC
low complexity region 104 115 N/A INTRINSIC
low complexity region 159 165 N/A INTRINSIC
G_patch 331 377 1.15e-17 SMART
Pfam:DND1_DSRM 398 452 7.9e-16 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000140312
AA Change: Q941R

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000122320
Gene: ENSMUSG00000022961
AA Change: Q941R

DomainStartEndE-ValueType
coiled coil region 106 132 N/A INTRINSIC
internal_repeat_1 155 350 2.93e-7 PROSPERO
internal_repeat_2 214 362 1.1e-5 PROSPERO
low complexity region 391 403 N/A INTRINSIC
low complexity region 459 469 N/A INTRINSIC
internal_repeat_1 507 750 2.93e-7 PROSPERO
low complexity region 975 1021 N/A INTRINSIC
low complexity region 1124 1135 N/A INTRINSIC
low complexity region 1141 1172 N/A INTRINSIC
internal_repeat_2 1208 1347 1.1e-5 PROSPERO
low complexity region 1354 1376 N/A INTRINSIC
low complexity region 1386 1407 N/A INTRINSIC
low complexity region 1805 1811 N/A INTRINSIC
low complexity region 1838 2067 N/A INTRINSIC
low complexity region 2080 2091 N/A INTRINSIC
low complexity region 2094 2105 N/A INTRINSIC
low complexity region 2149 2155 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000147891
SMART Domains Protein: ENSMUSP00000122544
Gene: ENSMUSG00000022961

DomainStartEndE-ValueType
Pfam:RSRP 61 358 2.9e-13 PFAM
low complexity region 466 477 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.1%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that contains multiple simple repeats. The encoded protein binds RNA and promotes pre-mRNA splicing, particularly of transcripts with poor splice sites. The protein also recognizes a specific DNA sequence found in the human hepatitis B virus (HBV) and represses HBV core promoter activity. There is a pseudogene for this gene on chromosome 1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk G A 11: 120,010,151 P1083S probably benign Het
Abcb5 T A 12: 118,944,906 N101I possibly damaging Het
Adrb2 A G 18: 62,179,553 V67A possibly damaging Het
Agk T A 6: 40,368,570 probably null Het
Akap10 A T 11: 61,886,777 M586K probably damaging Het
Akt3 A T 1: 177,050,190 Y337* probably null Het
Armc1 A G 3: 19,144,398 F133L possibly damaging Het
Bank1 T C 3: 136,093,308 E424G probably damaging Het
Cacna1a A G 8: 84,580,205 E1363G probably damaging Het
Cacna1d C A 14: 30,042,786 A2076S probably damaging Het
Ccdc73 T A 2: 104,991,524 L606* probably null Het
Ccdc8 C T 7: 16,996,637 Q684* probably null Het
Ces1b T A 8: 93,067,020 K314* probably null Het
Ces1e T A 8: 93,215,128 N238I probably damaging Het
Chd4 A G 6: 125,114,300 N1238S probably benign Het
Cmtr2 T A 8: 110,222,979 D640E probably damaging Het
Col7a1 C T 9: 108,958,128 T559I unknown Het
Comt T C 16: 18,408,021 K205R probably benign Het
Dbp A T 7: 45,708,404 E232V probably damaging Het
Dcbld2 A G 16: 58,456,130 T470A possibly damaging Het
Eml6 T A 11: 29,754,987 D1519V probably damaging Het
Evpl T A 11: 116,237,906 H31L possibly damaging Het
Exoc1 T A 5: 76,563,339 I86N probably damaging Het
Fat3 C T 9: 15,915,061 E4532K possibly damaging Het
Fgfr3 T C 5: 33,732,159 S301P probably benign Het
Gas2l1 C T 11: 5,064,254 V69I probably damaging Het
Gm2042 T A 12: 87,958,084 I107K probably damaging Het
Gucy1b1 T C 3: 82,039,747 D385G probably null Het
Ints1 T A 5: 139,765,175 E824D probably damaging Het
Itfg1 T C 8: 85,835,078 D142G probably benign Het
Jaml A G 9: 45,107,379 N359D probably benign Het
Kcnh7 T A 2: 62,850,377 I289L probably benign Het
Klf12 G A 14: 100,109,776 Q40* probably null Het
Mcm4 A C 16: 15,629,362 N579K possibly damaging Het
Mfsd2b A T 12: 4,867,358 F179I possibly damaging Het
Mmp11 C T 10: 75,928,374 V86M probably damaging Het
Mogs T C 6: 83,115,882 V101A probably damaging Het
Narf T A 11: 121,242,626 H84Q probably benign Het
Olfr987 C A 2: 85,331,798 M33I probably benign Het
Otog A C 7: 46,249,071 E204D probably benign Het
Parp8 G A 13: 116,895,115 H354Y possibly damaging Het
Pcnx C A 12: 81,964,480 D1238E probably damaging Het
Pi4ka A G 16: 17,376,982 L184P possibly damaging Het
Pkd1l3 C T 8: 109,624,449 T642I probably damaging Het
Pkhd1l1 G A 15: 44,589,663 E3995K probably benign Het
Prdm9 A T 17: 15,544,956 Y521N probably benign Het
Prex2 A G 1: 11,184,456 S1105G probably damaging Het
Prss35 T A 9: 86,756,100 F308I probably damaging Het
Rab22a C T 2: 173,701,055 A167V probably benign Het
Rims2 A G 15: 39,566,973 Q871R possibly damaging Het
Rorb A T 19: 18,957,247 M253K probably benign Het
Ryr3 T C 2: 112,652,610 D4269G probably damaging Het
Snx11 T C 11: 96,769,906 probably benign Het
Sptbn2 G T 19: 4,747,785 R1880L probably benign Het
Sun1 G A 5: 139,215,259 probably null Het
Tprn A G 2: 25,264,038 R451G probably benign Het
Trbv30 T A 6: 41,281,377 M1K probably null Het
Ttn C A 2: 76,738,221 G25697W probably damaging Het
Ubb T G 11: 62,551,527 probably null Het
Unc13b C T 4: 43,239,331 R1038C probably damaging Het
Usp7 T C 16: 8,696,911 M687V probably benign Het
Zfp160 G A 17: 21,020,734 M21I probably benign Het
Zfp868 T C 8: 69,612,096 N196S probably benign Het
Zufsp A T 10: 33,928,029 I483N probably damaging Het
Other mutations in Son
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00531:Son APN 16 91664322 missense probably damaging 0.99
IGL01024:Son APN 16 91655910 missense probably damaging 1.00
IGL01066:Son APN 16 91660136 intron probably benign
IGL01083:Son APN 16 91657391 missense probably damaging 1.00
IGL01115:Son APN 16 91659458 missense probably benign 0.31
IGL01467:Son APN 16 91657277 missense possibly damaging 0.93
IGL01506:Son APN 16 91657286 missense possibly damaging 0.67
IGL01933:Son APN 16 91658015 missense probably benign 0.00
IGL02156:Son APN 16 91656104 missense possibly damaging 0.93
IGL02473:Son APN 16 91658795 missense probably damaging 0.99
IGL02498:Son APN 16 91656825 missense probably damaging 0.99
IGL02517:Son APN 16 91655211 missense possibly damaging 0.92
IGL02530:Son APN 16 91658471 missense possibly damaging 0.50
IGL02865:Son APN 16 91651752 missense probably damaging 1.00
IGL03180:Son APN 16 91657008 missense probably damaging 1.00
R0013:Son UTSW 16 91651662 missense probably damaging 1.00
R0036:Son UTSW 16 91660166 intron probably benign
R0037:Son UTSW 16 91664728 missense probably damaging 1.00
R0041:Son UTSW 16 91659333 missense probably damaging 1.00
R0048:Son UTSW 16 91658977 missense possibly damaging 0.94
R0048:Son UTSW 16 91658977 missense possibly damaging 0.94
R0056:Son UTSW 16 91678155 missense possibly damaging 0.86
R0227:Son UTSW 16 91656873 missense probably damaging 0.99
R0256:Son UTSW 16 91656584 missense possibly damaging 0.95
R0302:Son UTSW 16 91656144 missense probably damaging 1.00
R0815:Son UTSW 16 91655484 missense probably damaging 0.98
R1225:Son UTSW 16 91657340 missense probably damaging 1.00
R1255:Son UTSW 16 91664695 missense probably damaging 1.00
R1457:Son UTSW 16 91657086 missense probably damaging 1.00
R1459:Son UTSW 16 91655342 missense possibly damaging 0.93
R1535:Son UTSW 16 91659734 missense probably damaging 0.99
R1587:Son UTSW 16 91659718 missense probably damaging 1.00
R1605:Son UTSW 16 91657664 missense probably damaging 1.00
R1629:Son UTSW 16 91657622 missense probably damaging 1.00
R1711:Son UTSW 16 91660226 intron probably benign
R2138:Son UTSW 16 91659372 missense possibly damaging 0.95
R2245:Son UTSW 16 91647960 splice site probably null
R2351:Son UTSW 16 91657659 missense probably damaging 0.98
R2434:Son UTSW 16 91654687 missense probably damaging 1.00
R2870:Son UTSW 16 91664317 splice site probably null
R2871:Son UTSW 16 91664317 splice site probably null
R2872:Son UTSW 16 91664317 splice site probably null
R2889:Son UTSW 16 91659899 unclassified probably benign
R3712:Son UTSW 16 91656726 missense probably damaging 0.99
R3913:Son UTSW 16 91660111 intron probably benign
R4172:Son UTSW 16 91659362 missense probably damaging 1.00
R4301:Son UTSW 16 91658411 missense possibly damaging 0.53
R4302:Son UTSW 16 91658411 missense possibly damaging 0.53
R4770:Son UTSW 16 91658868 missense probably damaging 0.96
R4881:Son UTSW 16 91675509 missense probably benign 0.31
R5020:Son UTSW 16 91656375 missense probably damaging 1.00
R5032:Son UTSW 16 91657664 missense probably damaging 1.00
R5151:Son UTSW 16 91655699 missense probably damaging 1.00
R5153:Son UTSW 16 91655022 missense possibly damaging 0.86
R5215:Son UTSW 16 91656675 missense probably damaging 0.99
R5243:Son UTSW 16 91654733 missense probably damaging 1.00
R5354:Son UTSW 16 91655739 missense probably damaging 0.99
R5529:Son UTSW 16 91655466 missense probably damaging 1.00
R5696:Son UTSW 16 91671413 missense possibly damaging 0.67
R5763:Son UTSW 16 91657490 missense probably damaging 1.00
R5766:Son UTSW 16 91664987 intron probably benign
R5788:Son UTSW 16 91660052 intron probably benign
R5992:Son UTSW 16 91658904 missense probably benign 0.04
R6314:Son UTSW 16 91660410 intron probably benign
R6371:Son UTSW 16 91674741
R6429:Son UTSW 16 91658166 missense probably benign 0.33
R6451:Son UTSW 16 91657602 missense probably damaging 0.99
R6489:Son UTSW 16 91655156 missense possibly damaging 0.70
R6513:Son UTSW 16 91659947 intron probably benign
R6916:Son UTSW 16 91654785 missense probably damaging 0.97
R7070:Son UTSW 16 91656841 unclassified probably benign
R7079:Son UTSW 16 91656841 unclassified probably benign
R7110:Son UTSW 16 91656518 missense probably benign 0.01
R7120:Son UTSW 16 91656691 unclassified probably benign
R7120:Son UTSW 16 91670526 missense unknown
R7167:Son UTSW 16 91660334 small deletion probably benign
R7205:Son UTSW 16 91660295 small deletion probably benign
R7208:Son UTSW 16 91662102 missense unknown
R7219:Son UTSW 16 91665001 missense unknown
R7249:Son UTSW 16 91660334 small deletion probably benign
R7328:Son UTSW 16 91658390 missense probably benign 0.33
R7330:Son UTSW 16 91656598 unclassified probably benign
R7374:Son UTSW 16 91660334 small deletion probably benign
R7405:Son UTSW 16 91656691 unclassified probably benign
R7420:Son UTSW 16 91660334 small deletion probably benign
R7424:Son UTSW 16 91660334 small deletion probably benign
R7464:Son UTSW 16 91656691 unclassified probably benign
R7514:Son UTSW 16 91654860 missense probably damaging 0.99
R7555:Son UTSW 16 91658922 missense probably damaging 0.99
R7645:Son UTSW 16 91660295 small deletion probably benign
R7716:Son UTSW 16 91656691 unclassified probably benign
R7718:Son UTSW 16 91660334 small deletion probably benign
R7778:Son UTSW 16 91656528 missense probably damaging 0.99
R7824:Son UTSW 16 91656528 missense probably damaging 0.99
R7856:Son UTSW 16 91659258 missense probably damaging 0.99
R7870:Son UTSW 16 91656598 unclassified probably benign
R7928:Son UTSW 16 91656841 unclassified probably benign
R7972:Son UTSW 16 91660334 small deletion probably benign
R7978:Son UTSW 16 91660334 small deletion probably benign
R8000:Son UTSW 16 91660334 small deletion probably benign
R8192:Son UTSW 16 91655549 missense possibly damaging 0.91
R8221:Son UTSW 16 91656846 missense probably damaging 1.00
R8227:Son UTSW 16 91656691 unclassified probably benign
R8233:Son UTSW 16 91660334 small deletion probably benign
R8255:Son UTSW 16 91664936 missense unknown
R8292:Son UTSW 16 91656657 missense possibly damaging 0.93
R8407:Son UTSW 16 91660334 small deletion probably benign
R8468:Son UTSW 16 91656691 unclassified probably benign
R8495:Son UTSW 16 91660295 small deletion probably benign
R8726:Son UTSW 16 91656691 unclassified probably benign
R8772:Son UTSW 16 91657938 missense possibly damaging 0.65
R8796:Son UTSW 16 91660334 small deletion probably benign
R8862:Son UTSW 16 91656846 missense probably damaging 1.00
RF007:Son UTSW 16 91659369 missense possibly damaging 0.53
RF041:Son UTSW 16 91656691 unclassified probably benign
Z1176:Son UTSW 16 91655801 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- AGATGTTAGCTTCTGGCACTATG -3'
(R):5'- CGTTCTGCAGCATAGGACATC -3'

Sequencing Primer
(F):5'- CACTATGGATGCTCAGATGTTAGC -3'
(R):5'- TCTGCAGCATAGGACATCATCATAG -3'
Posted On2018-08-01