Mutagenetix > Incidental Mutation

Incidental Mutation 'R9796:Taf2'

734962

Institutional Source

Beutler Lab

Gene Symbol

Taf2

Ensembl Gene

ENSMUSG00000037343

Gene Name

TATA-box binding protein associated factor 2

Synonyms

CIF150, 150kDa, TAF2B, 4732460C16Rik, TAFII150

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R9796 (G1)

Quality Score

182.009

Status

Not validated

Chromosome

Chromosomal Location

55015131-55072152 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 55047436 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Lysine at position 614 (M614K)

Ref Sequence

ENSEMBL: ENSMUSP00000043733 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041733]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000041733
AA Change: M614K

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000043733
Gene: ENSMUSG00000037343
AA Change: M614K

Domain	Start	End	E-Value	Type
Pfam:Peptidase_M1	21	406	5.6e-17	PFAM
SCOP:d1gw5a_	606	973	6e-7	SMART
low complexity region	987	998	N/A	INTRINSIC
low complexity region	1142	1175	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.8%
10x: 99.4%
20x: 98.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Initiation of transcription by RNA polymerase II requires the activities of more than 70 polypeptides. The protein that coordinates these activities is transcription factor IID (TFIID), which binds to the core promoter to position the polymerase properly, serves as the scaffold for assembly of the remainder of the transcription complex, and acts as a channel for regulatory signals. TFIID is composed of the TATA-binding protein (TBP) and a group of evolutionarily conserved proteins known as TBP-associated factors or TAFs. TAFs may participate in basal transcription, serve as coactivators, function in promoter recognition or modify general transcription factors (GTFs) to facilitate complex assembly and transcription initiation. This gene encodes one of the larger subunits of TFIID that is stably associated with the TFIID complex. It contributes to interactions at and downstream of the transcription initiation site, interactions that help determine transcription complex response to activators. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9330159F19Rik	C	T	10: 29,225,353	T574I	possibly damaging	Het
Aadac	T	G	3: 60,038,461	V184G	probably damaging	Het
Adam6b	G	A	12: 113,490,652	C363Y	probably damaging	Het
Adamts8	T	A	9: 30,951,273	I258N	probably damaging	Het
Adarb2	C	T	13: 8,569,816	L113F	probably damaging	Het
Aff4	A	G	11: 53,411,997	N1099S	probably damaging	Het
Alg10b	G	T	15: 90,224,525	A30S	possibly damaging	Het
Als2	T	A	1: 59,170,442	E1460D	probably benign	Het
Ascc3	C	T	10: 50,732,705	R1515*	probably null	Het
Asxl2	C	T	12: 3,496,508	P431S	probably benign	Het
AU018091	A	T	7: 3,163,955	V153D	probably damaging	Het
Cd177	A	G	7: 24,759,744	V80A	probably benign	Het
Cdc16	G	T	8: 13,757,693		probably benign	Het
Cdk14	A	G	5: 5,266,012	S4P	probably benign	Het
Ctu2	A	T	8: 122,476,250	Y8F	probably benign	Het
Dnhd1	T	C	7: 105,693,330	F1294L	probably damaging	Het
Epha7	A	G	4: 28,817,457	D37G	probably damaging	Het
Fan1	T	A	7: 64,372,530	N325I	probably benign	Het
Fbn1	T	A	2: 125,317,021	M2275L	probably benign	Het
Fbxo38	T	C	18: 62,540,984	K9E	possibly damaging	Het
Gm3696	T	C	14: 7,089,939	N48S	possibly damaging	Het
Greb1l	A	G	18: 10,538,233	E1082G	possibly damaging	Het
Gtdc1	A	T	2: 44,825,374	N52K	probably benign	Het
Hrh2	C	T	13: 54,221,222	T359I	probably benign	Het
Ifi44l	A	G	3: 151,762,782	V37A		Het
Igfn1	C	A	1: 135,969,873	W985L	probably benign	Het
Il23a	G	C	10: 128,296,960	R143G	probably benign	Het
Iltifb	A	G	10: 118,294,176	S108P	probably benign	Het
Kcnv1	T	C	15: 45,114,591	D17G	unknown	Het
Klk1	T	C	7: 44,228,541	W74R	possibly damaging	Het
Lmntd2	A	T	7: 141,213,684	N96K	possibly damaging	Het
Lrch4	A	G	5: 137,637,007	H253R	probably damaging	Het
Lrrc8d	A	T	5: 105,812,051	D109V	probably benign	Het
Magi3	T	C	3: 104,020,975	T1004A	probably benign	Het
Mapk10	A	G	5: 102,987,235	V287A	possibly damaging	Het
Mtss1l	G	A	8: 110,730,121		probably null	Het
Mybpc1	T	C	10: 88,570,635	I116V	possibly damaging	Het
Mylk4	T	A	13: 32,716,660	M296L	probably damaging	Het
Nav3	A	G	10: 109,692,108	F2238S	probably damaging	Het
Olfr742	G	T	14: 50,515,772	L189F	probably damaging	Het
Park2	A	T	17: 11,237,667	D126V	possibly damaging	Het
Pax6	T	C	2: 105,692,196	F243L	probably damaging	Het
Pcdhb22	G	A	18: 37,519,351	E34K	possibly damaging	Het
Pdzrn4	T	A	15: 92,680,472	F359I	possibly damaging	Het
Rnf168	C	T	16: 32,299,054	R478C	probably damaging	Het
Sh3gl2	G	A	4: 85,377,528	V156I	possibly damaging	Het
Tbc1d31	G	A	15: 57,969,783	V973M	probably damaging	Het
Tmem131l	T	G	3: 83,922,095	K1085T	probably damaging	Het
Tpst1	A	G	5: 130,134,459	T366A	probably benign	Het
Unc50	A	G	1: 37,432,598	T110A	probably benign	Het
Vmn2r60	A	G	7: 42,135,748	H128R	probably benign	Het
Vps13a	A	T	19: 16,654,464	N2602K	probably benign	Het
Vps13d	A	G	4: 145,127,935		probably null	Het
Vps50	A	G	6: 3,562,300	E465G	probably damaging	Het

Other mutations in Taf2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00331:Taf2	APN	15	55071449	critical splice acceptor site	probably null
IGL00475:Taf2	APN	15	55055850	nonsense	probably null
IGL00549:Taf2	APN	15	55031115	missense	probably benign	0.03
IGL00839:Taf2	APN	15	55045778	nonsense	probably null
IGL01089:Taf2	APN	15	55016581	missense	probably benign
IGL01305:Taf2	APN	15	55048274	missense	probably damaging	0.99
IGL01532:Taf2	APN	15	55049486	missense	possibly damaging	0.94
IGL01903:Taf2	APN	15	55060016	missense	probably benign	0.03
IGL02324:Taf2	APN	15	55028376	missense	probably benign
IGL02328:Taf2	APN	15	55028376	missense	probably benign
IGL02405:Taf2	APN	15	55034155	splice site	probably benign
IGL02671:Taf2	APN	15	55034176	missense	probably benign	0.01
IGL02832:Taf2	APN	15	55016563	missense	probably benign	0.01
IGL03105:Taf2	APN	15	55045799	missense	probably benign	0.26
IGL03118:Taf2	APN	15	55052163	missense	probably damaging	1.00
ANU22:Taf2	UTSW	15	55048274	missense	probably damaging	0.99
R0104:Taf2	UTSW	15	55038338	missense	probably benign	0.02
R0104:Taf2	UTSW	15	55038338	missense	probably benign	0.02
R0183:Taf2	UTSW	15	55055790	missense	possibly damaging	0.89
R0326:Taf2	UTSW	15	55047460	missense	probably damaging	0.97
R0362:Taf2	UTSW	15	55045929	missense	probably damaging	1.00
R0423:Taf2	UTSW	15	55064682	missense	probably benign	0.02
R0562:Taf2	UTSW	15	55022188	splice site	probably benign
R0609:Taf2	UTSW	15	55060050	missense	probably damaging	1.00
R0655:Taf2	UTSW	15	55038294	missense	probably damaging	1.00
R0689:Taf2	UTSW	15	55063065	missense	possibly damaging	0.60
R0743:Taf2	UTSW	15	55016461	small deletion	probably benign
R0898:Taf2	UTSW	15	55060084	missense	probably damaging	0.97
R0969:Taf2	UTSW	15	55031157	critical splice acceptor site	probably null
R0974:Taf2	UTSW	15	55016461	small deletion	probably benign
R1145:Taf2	UTSW	15	55016461	small deletion	probably benign
R1145:Taf2	UTSW	15	55016461	small deletion	probably benign
R1160:Taf2	UTSW	15	55071397	missense	probably benign	0.01
R1376:Taf2	UTSW	15	55016461	small deletion	probably benign
R1388:Taf2	UTSW	15	55036625	missense	probably benign	0.00
R1416:Taf2	UTSW	15	55038410	missense	possibly damaging	0.95
R1458:Taf2	UTSW	15	55059915	missense	probably damaging	0.99
R1477:Taf2	UTSW	15	55062172	missense	possibly damaging	0.87
R1755:Taf2	UTSW	15	55016454	missense	probably damaging	1.00
R1766:Taf2	UTSW	15	55071397	missense	probably benign	0.01
R2090:Taf2	UTSW	15	55016486	missense	probably damaging	0.99
R2228:Taf2	UTSW	15	55064646	missense	possibly damaging	0.94
R2519:Taf2	UTSW	15	55052247	missense	probably benign	0.03
R4073:Taf2	UTSW	15	55052237	missense	probably damaging	1.00
R4470:Taf2	UTSW	15	55058880	missense	possibly damaging	0.70
R4471:Taf2	UTSW	15	55058880	missense	possibly damaging	0.70
R4472:Taf2	UTSW	15	55058880	missense	possibly damaging	0.70
R4716:Taf2	UTSW	15	55065968	missense	probably benign	0.02
R4937:Taf2	UTSW	15	55027223	nonsense	probably null
R5082:Taf2	UTSW	15	55060045	missense	probably benign	0.41
R5335:Taf2	UTSW	15	55045740	missense	probably benign	0.14
R5383:Taf2	UTSW	15	55049419	missense	possibly damaging	0.78
R5771:Taf2	UTSW	15	55059939	missense	probably benign	0.01
R5862:Taf2	UTSW	15	55048323	missense	possibly damaging	0.95
R5873:Taf2	UTSW	15	55038422	missense	probably benign	0.00
R5908:Taf2	UTSW	15	55072006	unclassified	probably benign
R6033:Taf2	UTSW	15	55058901	missense	probably damaging	1.00
R6033:Taf2	UTSW	15	55058901	missense	probably damaging	1.00
R6159:Taf2	UTSW	15	55063044	missense	possibly damaging	0.48
R6568:Taf2	UTSW	15	55064630	missense	probably damaging	1.00
R7094:Taf2	UTSW	15	55060086	missense	probably benign	0.27
R7174:Taf2	UTSW	15	55048739	missense	possibly damaging	0.51
R7241:Taf2	UTSW	15	55062141	missense	probably benign	0.01
R7561:Taf2	UTSW	15	55055833	missense	probably benign	0.16
R7583:Taf2	UTSW	15	55064676	nonsense	probably null
R7818:Taf2	UTSW	15	55065930	missense	probably benign
R7905:Taf2	UTSW	15	55047432	missense	possibly damaging	0.90
R8006:Taf2	UTSW	15	55048701	missense	probably damaging	1.00
R8017:Taf2	UTSW	15	55064617	missense	possibly damaging	0.66
R8019:Taf2	UTSW	15	55064617	missense	possibly damaging	0.66
R8119:Taf2	UTSW	15	55031130	missense	probably benign	0.00
R8127:Taf2	UTSW	15	55059988	missense	probably damaging	1.00
R8128:Taf2	UTSW	15	55059988	missense	probably damaging	1.00
R8129:Taf2	UTSW	15	55059988	missense	probably damaging	1.00
R8278:Taf2	UTSW	15	55065965	nonsense	probably null
R8290:Taf2	UTSW	15	55063020	missense	probably damaging	1.00
R8762:Taf2	UTSW	15	55047453	missense	probably benign	0.16
R8832:Taf2	UTSW	15	55064605	missense	possibly damaging	0.86
R8916:Taf2	UTSW	15	55036535	missense	probably benign	0.26
R8937:Taf2	UTSW	15	55047453	missense	probably benign	0.16
R9006:Taf2	UTSW	15	55045905	missense	possibly damaging	0.94
R9138:Taf2	UTSW	15	55016461	small deletion	probably benign
R9240:Taf2	UTSW	15	55063068	missense	probably null	1.00
R9257:Taf2	UTSW	15	55066013	missense	possibly damaging	0.46
R9485:Taf2	UTSW	15	55048271	missense	probably benign	0.05
R9762:Taf2	UTSW	15	55031044	critical splice donor site	probably null
R9766:Taf2	UTSW	15	55047485	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- GATTGCCCTAAGTCGCATGC -3'
(R):5'- GTTTTCACACTCCATGTCAGTG -3'

Sequencing Primer
(F):5'- CCCTAAGTCGCATGCATATCAATGTG -3'
(R):5'- ATGTCAGTGTTCACTCCACTTTG -3'

Posted On

2022-11-14