Mutagenetix > Incidental Mutation

Incidental Mutation 'R9485:Taf2'

716545

Institutional Source

Beutler Lab

Gene Symbol

Taf2

Ensembl Gene

ENSMUSG00000037343

Gene Name

TATA-box binding protein associated factor 2

Synonyms

CIF150, 150kDa, TAF2B, 4732460C16Rik, TAFII150

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R9485 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

55015131-55072152 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 55048271 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 583 (E583G)

Ref Sequence

ENSEMBL: ENSMUSP00000043733 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041733]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000041733
AA Change: E583G

PolyPhen 2 Score 0.050 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000043733
Gene: ENSMUSG00000037343
AA Change: E583G

Domain	Start	End	E-Value	Type
Pfam:Peptidase_M1	21	406	5.6e-17	PFAM
SCOP:d1gw5a_	606	973	6e-7	SMART
low complexity region	987	998	N/A	INTRINSIC
low complexity region	1142	1175	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Initiation of transcription by RNA polymerase II requires the activities of more than 70 polypeptides. The protein that coordinates these activities is transcription factor IID (TFIID), which binds to the core promoter to position the polymerase properly, serves as the scaffold for assembly of the remainder of the transcription complex, and acts as a channel for regulatory signals. TFIID is composed of the TATA-binding protein (TBP) and a group of evolutionarily conserved proteins known as TBP-associated factors or TAFs. TAFs may participate in basal transcription, serve as coactivators, function in promoter recognition or modify general transcription factors (GTFs) to facilitate complex assembly and transcription initiation. This gene encodes one of the larger subunits of TFIID that is stably associated with the TFIID complex. It contributes to interactions at and downstream of the transcription initiation site, interactions that help determine transcription complex response to activators. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700016C15Rik	T	C	1: 177,752,979	V130A	possibly damaging	Het
3425401B19Rik	T	C	14: 32,661,443	D855G	possibly damaging	Het
4930486L24Rik	A	T	13: 60,853,245	V159D	possibly damaging	Het
Ahnak	G	A	19: 9,002,074	A241T	probably benign	Het
Apoa4	T	C	9: 46,241,155	M1T	probably null	Het
Atn1	T	C	6: 124,745,785	K776E	unknown	Het
Atp1a2	A	G	1: 172,278,255	*948R	probably null	Het
Atp7b	T	C	8: 22,012,762	Q801R	probably damaging	Het
Birc6	T	A	17: 74,638,403	S2824T	probably damaging	Het
Cacng3	A	T	7: 122,762,212	I109F	probably damaging	Het
Cass4	T	C	2: 172,427,885	F629S	probably benign	Het
Cnot6l	T	C	5: 96,082,999	T370A	probably damaging	Het
Cntnap5c	A	C	17: 58,102,108	D447A	probably damaging	Het
Col11a2	T	A	17: 34,039,695	L14Q	unknown	Het
Dennd4a	T	G	9: 64,907,106	Y1505*	probably null	Het
Dhx32	T	C	7: 133,725,381	M464V	possibly damaging	Het
Diexf	C	A	1: 193,130,233		probably benign	Het
Dip2b	T	C	15: 100,155,043	V266A	probably benign	Het
Dnajb6	C	T	5: 29,781,519	Q220*	probably null	Het
Dnmt3a	G	A	12: 3,866,121	S102N	probably benign	Het
Dph5	A	T	3: 115,888,328		probably benign	Het
Ear6	T	A	14: 51,854,032	L12H		Het
Erp27	T	C	6: 136,909,550	T162A	possibly damaging	Het
Fance	T	A	17: 28,317,505	L13H	probably damaging	Het
Fanci	T	A	7: 79,439,657	V947D	probably benign	Het
Gab1	G	A	8: 80,788,855	T278M	probably damaging	Het
Gbp4	A	T	5: 105,121,930	M344K	probably damaging	Het
Gm8251	T	G	1: 44,056,239	K1900Q	possibly damaging	Het
Gpr87	C	T	3: 59,179,584	V167M	possibly damaging	Het
Gramd1a	T	G	7: 31,130,538	D708A	unknown	Het
Gzmd	T	A	14: 56,130,703	I100F	probably benign	Het
Hcrtr1	T	A	4: 130,137,261	M77L	possibly damaging	Het
Hipk2	C	A	6: 38,703,510	R965L	possibly damaging	Het
Ift88	T	C	14: 57,438,267	M79T	probably benign	Het
Ighv1-12	T	C	12: 114,615,905	Y99C	possibly damaging	Het
Il1rl2	CTTTATTTTATTTTATTTTATTTTATTTTATTTTATTTTATT	CTTTATTTTATTTTATTTTATTTTATTTTATTTTATT	1: 40,327,310		probably benign	Het
Iltifb	A	G	10: 118,294,409	V63A	probably benign	Het
Mllt1	C	T	17: 56,900,184	R220H	probably damaging	Het
Mroh8	T	C	2: 157,229,993	T531A	probably benign	Het
Myh6	T	C	14: 54,944,345	K1833R	probably benign	Het
Nfkbie	C	T	17: 45,560,427	T270I	probably damaging	Het
Olfr1215	G	A	2: 89,001,365	P308S	unknown	Het
Olfr549	A	T	7: 102,554,806	N174I	probably damaging	Het
Olfr678	C	T	7: 105,069,496	H10Y	possibly damaging	Het
Pcdh8	A	T	14: 79,768,249	F900I	probably damaging	Het
Pcolce2	T	A	9: 95,638,667	C32*	probably null	Het
Pus7	A	T	5: 23,768,861	S212T	probably benign	Het
Rgs12	G	T	5: 35,032,270	W1322L	probably damaging	Het
Sec1	G	A	7: 45,678,609	T338I	probably damaging	Het
Slc25a36	T	C	9: 97,080,469	K156E	probably benign	Het
Snrpn	C	T	7: 59,987,464	D35N	probably damaging	Het
Sox9	A	G	11: 112,782,879	S99G	probably benign	Het
Tacc3	T	C	5: 33,664,300	S135P	possibly damaging	Het
Tmprss7	T	A	16: 45,677,919	K366*	probably null	Het
Trpm6	G	T	19: 18,778,614	V74L	probably benign	Het
Ttbk2	G	T	2: 120,745,505	T997N	probably benign	Het
Vmn2r3	T	A	3: 64,275,625	I218F	probably damaging	Het
Vps50	T	C	6: 3,592,557	V730A	probably damaging	Het
Wdr47	A	T	3: 108,637,055	I665F	probably damaging	Het
Wnt7a	T	A	6: 91,366,315	N195I	probably benign	Het
Zfp131	A	G	13: 119,790,349		probably benign	Het
Zfp709	T	A	8: 71,889,825	V366E	possibly damaging	Het
Zfp985	T	A	4: 147,583,823	C383S	probably damaging	Het

Other mutations in Taf2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00331:Taf2	APN	15	55071449	critical splice acceptor site	probably null
IGL00475:Taf2	APN	15	55055850	nonsense	probably null
IGL00549:Taf2	APN	15	55031115	missense	probably benign	0.03
IGL00839:Taf2	APN	15	55045778	nonsense	probably null
IGL01089:Taf2	APN	15	55016581	missense	probably benign
IGL01305:Taf2	APN	15	55048274	missense	probably damaging	0.99
IGL01532:Taf2	APN	15	55049486	missense	possibly damaging	0.94
IGL01903:Taf2	APN	15	55060016	missense	probably benign	0.03
IGL02324:Taf2	APN	15	55028376	missense	probably benign
IGL02328:Taf2	APN	15	55028376	missense	probably benign
IGL02405:Taf2	APN	15	55034155	splice site	probably benign
IGL02671:Taf2	APN	15	55034176	missense	probably benign	0.01
IGL02832:Taf2	APN	15	55016563	missense	probably benign	0.01
IGL03105:Taf2	APN	15	55045799	missense	probably benign	0.26
IGL03118:Taf2	APN	15	55052163	missense	probably damaging	1.00
ANU22:Taf2	UTSW	15	55048274	missense	probably damaging	0.99
R0104:Taf2	UTSW	15	55038338	missense	probably benign	0.02
R0104:Taf2	UTSW	15	55038338	missense	probably benign	0.02
R0183:Taf2	UTSW	15	55055790	missense	possibly damaging	0.89
R0326:Taf2	UTSW	15	55047460	missense	probably damaging	0.97
R0362:Taf2	UTSW	15	55045929	missense	probably damaging	1.00
R0423:Taf2	UTSW	15	55064682	missense	probably benign	0.02
R0562:Taf2	UTSW	15	55022188	splice site	probably benign
R0609:Taf2	UTSW	15	55060050	missense	probably damaging	1.00
R0655:Taf2	UTSW	15	55038294	missense	probably damaging	1.00
R0689:Taf2	UTSW	15	55063065	missense	possibly damaging	0.60
R0743:Taf2	UTSW	15	55016461	small deletion	probably benign
R0898:Taf2	UTSW	15	55060084	missense	probably damaging	0.97
R0969:Taf2	UTSW	15	55031157	critical splice acceptor site	probably null
R0974:Taf2	UTSW	15	55016461	small deletion	probably benign
R1145:Taf2	UTSW	15	55016461	small deletion	probably benign
R1145:Taf2	UTSW	15	55016461	small deletion	probably benign
R1160:Taf2	UTSW	15	55071397	missense	probably benign	0.01
R1376:Taf2	UTSW	15	55016461	small deletion	probably benign
R1388:Taf2	UTSW	15	55036625	missense	probably benign	0.00
R1416:Taf2	UTSW	15	55038410	missense	possibly damaging	0.95
R1458:Taf2	UTSW	15	55059915	missense	probably damaging	0.99
R1477:Taf2	UTSW	15	55062172	missense	possibly damaging	0.87
R1755:Taf2	UTSW	15	55016454	missense	probably damaging	1.00
R1766:Taf2	UTSW	15	55071397	missense	probably benign	0.01
R2090:Taf2	UTSW	15	55016486	missense	probably damaging	0.99
R2228:Taf2	UTSW	15	55064646	missense	possibly damaging	0.94
R2519:Taf2	UTSW	15	55052247	missense	probably benign	0.03
R4073:Taf2	UTSW	15	55052237	missense	probably damaging	1.00
R4470:Taf2	UTSW	15	55058880	missense	possibly damaging	0.70
R4471:Taf2	UTSW	15	55058880	missense	possibly damaging	0.70
R4472:Taf2	UTSW	15	55058880	missense	possibly damaging	0.70
R4716:Taf2	UTSW	15	55065968	missense	probably benign	0.02
R4937:Taf2	UTSW	15	55027223	nonsense	probably null
R5082:Taf2	UTSW	15	55060045	missense	probably benign	0.41
R5335:Taf2	UTSW	15	55045740	missense	probably benign	0.14
R5383:Taf2	UTSW	15	55049419	missense	possibly damaging	0.78
R5771:Taf2	UTSW	15	55059939	missense	probably benign	0.01
R5862:Taf2	UTSW	15	55048323	missense	possibly damaging	0.95
R5873:Taf2	UTSW	15	55038422	missense	probably benign	0.00
R5908:Taf2	UTSW	15	55072006	unclassified	probably benign
R6033:Taf2	UTSW	15	55058901	missense	probably damaging	1.00
R6033:Taf2	UTSW	15	55058901	missense	probably damaging	1.00
R6159:Taf2	UTSW	15	55063044	missense	possibly damaging	0.48
R6568:Taf2	UTSW	15	55064630	missense	probably damaging	1.00
R7094:Taf2	UTSW	15	55060086	missense	probably benign	0.27
R7174:Taf2	UTSW	15	55048739	missense	possibly damaging	0.51
R7241:Taf2	UTSW	15	55062141	missense	probably benign	0.01
R7561:Taf2	UTSW	15	55055833	missense	probably benign	0.16
R7583:Taf2	UTSW	15	55064676	nonsense	probably null
R7818:Taf2	UTSW	15	55065930	missense	probably benign
R7905:Taf2	UTSW	15	55047432	missense	possibly damaging	0.90
R8006:Taf2	UTSW	15	55048701	missense	probably damaging	1.00
R8017:Taf2	UTSW	15	55064617	missense	possibly damaging	0.66
R8019:Taf2	UTSW	15	55064617	missense	possibly damaging	0.66
R8119:Taf2	UTSW	15	55031130	missense	probably benign	0.00
R8127:Taf2	UTSW	15	55059988	missense	probably damaging	1.00
R8128:Taf2	UTSW	15	55059988	missense	probably damaging	1.00
R8129:Taf2	UTSW	15	55059988	missense	probably damaging	1.00
R8278:Taf2	UTSW	15	55065965	nonsense	probably null
R8290:Taf2	UTSW	15	55063020	missense	probably damaging	1.00
R8762:Taf2	UTSW	15	55047453	missense	probably benign	0.16
R8832:Taf2	UTSW	15	55064605	missense	possibly damaging	0.86
R8916:Taf2	UTSW	15	55036535	missense	probably benign	0.26
R8937:Taf2	UTSW	15	55047453	missense	probably benign	0.16
R9006:Taf2	UTSW	15	55045905	missense	possibly damaging	0.94
R9138:Taf2	UTSW	15	55016461	small deletion	probably benign
R9240:Taf2	UTSW	15	55063068	missense	probably null	1.00
R9257:Taf2	UTSW	15	55066013	missense	possibly damaging	0.46
R9762:Taf2	UTSW	15	55031044	critical splice donor site	probably null
R9766:Taf2	UTSW	15	55047485	critical splice acceptor site	probably null
R9796:Taf2	UTSW	15	55047436	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- CAGACAAAGTATGCATGGCAC -3'
(R):5'- ACCAGCTGCGGTTGTACTTC -3'

Sequencing Primer
(F):5'- CTACTCTGATGTAGCACAGGAGC -3'
(R):5'- CTATGTCTTGGCCATTGGT -3'

Posted On

2022-07-18