Incidental Mutation 'R0825:Strbp'
ID78165
Institutional Source Beutler Lab
Gene Symbol Strbp
Ensembl Gene ENSMUSG00000026915
Gene Namespermatid perinuclear RNA binding protein
Synonyms6430510M02Rik, Spnr, C230082I21Rik
MMRRC Submission 039005-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.461) question?
Stock #R0825 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location37483228-37703859 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 37635527 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 144 (N144K)
Ref Sequence ENSEMBL: ENSMUSP00000139145 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028279] [ENSMUST00000072186] [ENSMUST00000145808] [ENSMUST00000183690]
Predicted Effect probably benign
Transcript: ENSMUST00000028279
AA Change: N144K

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000028279
Gene: ENSMUSG00000026915
AA Change: N144K

DomainStartEndE-ValueType
DZF 81 334 2.45e-168 SMART
DSRM 388 452 3.11e-16 SMART
low complexity region 474 497 N/A INTRINSIC
DSRM 511 575 1.2e-22 SMART
low complexity region 578 593 N/A INTRINSIC
low complexity region 608 618 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000072186
AA Change: N144K

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000072047
Gene: ENSMUSG00000026915
AA Change: N144K

DomainStartEndE-ValueType
DZF 81 334 2.45e-168 SMART
DSRM 388 452 3.11e-16 SMART
low complexity region 474 497 N/A INTRINSIC
DSRM 511 575 1.2e-22 SMART
low complexity region 578 593 N/A INTRINSIC
low complexity region 608 618 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135488
Predicted Effect probably benign
Transcript: ENSMUST00000145808
AA Change: N144K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000120163
Gene: ENSMUSG00000026915
AA Change: N144K

DomainStartEndE-ValueType
Pfam:DZF 87 167 1.4e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000183690
AA Change: N144K

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000139145
Gene: ENSMUSG00000026915
AA Change: N144K

DomainStartEndE-ValueType
DZF 81 334 2.45e-168 SMART
DSRM 388 452 3.11e-16 SMART
low complexity region 474 497 N/A INTRINSIC
DSRM 511 575 1.2e-22 SMART
low complexity region 578 593 N/A INTRINSIC
low complexity region 608 618 N/A INTRINSIC
Meta Mutation Damage Score 0.0657 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.4%
  • 20x: 91.4%
Validation Efficiency 98% (46/47)
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trap insertion exhibit premature death, a reduced body size and an abnormal clutching reflex. Minor brain abnormalities and spermatogenesis defects were also noted. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 T A 17: 24,400,577 I963N probably damaging Het
AF529169 G A 9: 89,603,279 Q22* probably null Het
Aox4 A G 1: 58,248,909 D727G possibly damaging Het
Arhgef26 T A 3: 62,426,593 I590N probably damaging Het
Arid1b T G 17: 5,342,178 C1994W probably damaging Het
Chd9 T C 8: 91,051,197 I2628T probably benign Het
Clspn G A 4: 126,573,130 probably benign Het
Cyp2a4 A T 7: 26,312,916 T375S probably benign Het
Dmtf1 A T 5: 9,130,388 M226K probably damaging Het
Erap1 T C 13: 74,674,614 probably benign Het
Frmpd1 A G 4: 45,285,394 D1405G possibly damaging Het
Gfm2 A T 13: 97,143,104 probably benign Het
Ghsr T C 3: 27,374,627 V267A probably damaging Het
Golga2 A C 2: 32,304,791 Q650P probably damaging Het
Hmgcl A G 4: 135,960,070 T219A probably benign Het
Ift27 C A 15: 78,165,136 probably benign Het
Igfn1 C T 1: 135,963,126 E2379K probably damaging Het
Iqca C A 1: 90,142,731 G133V probably null Het
Kpnb1 A T 11: 97,171,675 S421R probably damaging Het
Mtx3 C A 13: 92,850,341 T264K probably damaging Het
Nrg3 G A 14: 39,472,391 P137L possibly damaging Het
Nt5c2 A G 19: 46,898,905 probably benign Het
Olfr1391 T A 11: 49,327,682 H90Q probably benign Het
Olfr199 G T 16: 59,216,450 H54Q possibly damaging Het
Pcdhb2 G A 18: 37,295,657 V228I possibly damaging Het
Pdcd5 G A 7: 35,646,913 R91W possibly damaging Het
Pxdn G A 12: 29,984,996 probably benign Het
Rgl2 T A 17: 33,935,159 probably null Het
Rnf217 T C 10: 31,517,457 D376G probably damaging Het
Sept9 C T 11: 117,359,460 L519F probably damaging Het
Slc15a5 C T 6: 138,018,089 C386Y possibly damaging Het
Srrm4 T A 5: 116,453,713 I256F unknown Het
Stab1 G T 14: 31,152,600 D950E probably benign Het
Stim2 A G 5: 54,118,483 T667A probably benign Het
Sync A G 4: 129,293,397 Y74C probably benign Het
Terb1 A T 8: 104,468,748 M587K possibly damaging Het
Tgfbi T C 13: 56,638,710 probably benign Het
Tmf1 A T 6: 97,175,995 N372K probably benign Het
Ubr4 G T 4: 139,479,576 probably null Het
Uggt1 A T 1: 36,158,143 N1226K probably benign Het
Ugt2b34 T C 5: 86,906,701 I74V possibly damaging Het
Wdfy3 A G 5: 101,870,051 L2541P probably damaging Het
Zfhx3 T G 8: 108,949,208 F2297V probably damaging Het
Other mutations in Strbp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Strbp APN 2 37586504 splice site probably benign
IGL00656:Strbp APN 2 37603138 splice site probably benign
IGL01376:Strbp APN 2 37645651 missense probably damaging 1.00
IGL01998:Strbp APN 2 37625285 missense probably damaging 1.00
IGL02347:Strbp APN 2 37645648 missense probably benign 0.25
IGL02453:Strbp APN 2 37586508 critical splice donor site probably null
IGL02804:Strbp APN 2 37624486 splice site probably benign
IGL03102:Strbp APN 2 37586503 splice site probably benign
PIT4418001:Strbp UTSW 2 37645492 missense probably benign
R0382:Strbp UTSW 2 37600826 missense probably benign 0.00
R0575:Strbp UTSW 2 37640873 missense possibly damaging 0.87
R0610:Strbp UTSW 2 37584077 missense probably damaging 0.97
R1829:Strbp UTSW 2 37640909 missense possibly damaging 0.63
R1831:Strbp UTSW 2 37625265 missense possibly damaging 0.71
R3416:Strbp UTSW 2 37590725 missense possibly damaging 0.94
R3417:Strbp UTSW 2 37590725 missense possibly damaging 0.94
R4673:Strbp UTSW 2 37645679 missense probably damaging 1.00
R5093:Strbp UTSW 2 37627487 missense probably damaging 0.99
R5099:Strbp UTSW 2 37603018 missense probably damaging 0.98
R5269:Strbp UTSW 2 37627443 missense possibly damaging 0.87
R5378:Strbp UTSW 2 37599174 missense probably damaging 1.00
R5378:Strbp UTSW 2 37600806 missense probably benign 0.03
R5454:Strbp UTSW 2 37645483 missense probably benign 0.00
R5905:Strbp UTSW 2 37625255 missense probably damaging 1.00
R6028:Strbp UTSW 2 37625255 missense probably damaging 1.00
R6374:Strbp UTSW 2 37603008 missense probably damaging 1.00
R6700:Strbp UTSW 2 37603963 missense probably null 0.01
R6800:Strbp UTSW 2 37625216 missense probably damaging 1.00
R7032:Strbp UTSW 2 37603113 missense possibly damaging 0.92
R7139:Strbp UTSW 2 37624502 missense probably benign 0.00
R7261:Strbp UTSW 2 37641137 splice site probably null
R7481:Strbp UTSW 2 37600754 missense probably benign 0.02
R7718:Strbp UTSW 2 37625282 missense probably damaging 1.00
R7959:Strbp UTSW 2 37640894 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACCACTAAGCCAGTATAGTAGAGCAGG -3'
(R):5'- AGCAAGGAACTAATTTCAGTTGTGGGT -3'

Sequencing Primer
(F):5'- AGTCTGTGACTTCCTAAATCCCAAG -3'
(R):5'- AATTTCAGTTGTGGGTCTTATATGC -3'
Posted On2013-10-16