Incidental Mutation 'R0825:Kpnb1'
ID 78187
Institutional Source Beutler Lab
Gene Symbol Kpnb1
Ensembl Gene ENSMUSG00000001440
Gene Name karyopherin subunit beta 1
Synonyms Impnb
MMRRC Submission 039005-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R0825 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 97050540-97078707 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 97062501 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Arginine at position 421 (S421R)
Ref Sequence ENSEMBL: ENSMUSP00000001479 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001479]
AlphaFold P70168
PDB Structure N-TERMINAL FRAGMENT OF IMPORTIN-BETA [X-RAY DIFFRACTION]
Crystal structure of Importin-beta and SREBP-2 complex [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000001479
AA Change: S421R

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000001479
Gene: ENSMUSG00000001440
AA Change: S421R

DomainStartEndE-ValueType
IBN_N 21 101 3.72e-5 SMART
Blast:ARM 158 203 4e-7 BLAST
Pfam:HEAT_EZ 380 435 3e-13 PFAM
Pfam:HEAT 409 439 2.6e-7 PFAM
Blast:ARM 440 477 7e-17 BLAST
low complexity region 478 495 N/A INTRINSIC
Blast:IBN_N 528 590 9e-25 BLAST
Blast:ARM 594 637 1e-18 BLAST
Blast:ARM 784 827 1e-5 BLAST
Meta Mutation Damage Score 0.1483 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.4%
  • 20x: 91.4%
Validation Efficiency 98% (46/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Nucleocytoplasmic transport, a signal- and energy-dependent process, takes place through nuclear pore complexes embedded in the nuclear envelope. The import of proteins containing a nuclear localization signal (NLS) requires the NLS import receptor, a heterodimer of importin alpha and beta subunits also known as karyopherins. Importin alpha binds the NLS-containing cargo in the cytoplasm and importin beta docks the complex at the cytoplasmic side of the nuclear pore complex. In the presence of nucleoside triphosphates and the small GTP binding protein Ran, the complex moves into the nuclear pore complex and the importin subunits dissociate. Importin alpha enters the nucleoplasm with its passenger protein and importin beta remains at the pore. Interactions between importin beta and the FG repeats of nucleoporins are essential in translocation through the pore complex. The protein encoded by this gene is a member of the importin beta family. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2013]
PHENOTYPE: Homozygous mutation of this gene results in lethality shortly after implantation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 T A 17: 24,619,551 (GRCm39) I963N probably damaging Het
Aox4 A G 1: 58,288,068 (GRCm39) D727G possibly damaging Het
Arhgef26 T A 3: 62,334,014 (GRCm39) I590N probably damaging Het
Arid1b T G 17: 5,392,453 (GRCm39) C1994W probably damaging Het
Chd9 T C 8: 91,777,825 (GRCm39) I2628T probably benign Het
Clspn G A 4: 126,466,923 (GRCm39) probably benign Het
Cyp2a4 A T 7: 26,012,341 (GRCm39) T375S probably benign Het
Dmtf1 A T 5: 9,180,388 (GRCm39) M226K probably damaging Het
Erap1 T C 13: 74,822,733 (GRCm39) probably benign Het
Frmpd1 A G 4: 45,285,394 (GRCm39) D1405G possibly damaging Het
Gfm2 A T 13: 97,279,612 (GRCm39) probably benign Het
Ghsr T C 3: 27,428,776 (GRCm39) V267A probably damaging Het
Golga2 A C 2: 32,194,803 (GRCm39) Q650P probably damaging Het
Hmgcl A G 4: 135,687,381 (GRCm39) T219A probably benign Het
Ift27 C A 15: 78,049,336 (GRCm39) probably benign Het
Igfn1 C T 1: 135,890,864 (GRCm39) E2379K probably damaging Het
Iqca1 C A 1: 90,070,453 (GRCm39) G133V probably null Het
Minar1 G A 9: 89,485,332 (GRCm39) Q22* probably null Het
Mtx3 C A 13: 92,986,849 (GRCm39) T264K probably damaging Het
Nrg3 G A 14: 39,194,348 (GRCm39) P137L possibly damaging Het
Nt5c2 A G 19: 46,887,344 (GRCm39) probably benign Het
Or2y1e T A 11: 49,218,509 (GRCm39) H90Q probably benign Het
Or5ac17 G T 16: 59,036,813 (GRCm39) H54Q possibly damaging Het
Pcdhb2 G A 18: 37,428,710 (GRCm39) V228I possibly damaging Het
Pdcd5 G A 7: 35,346,338 (GRCm39) R91W possibly damaging Het
Pxdn G A 12: 30,034,995 (GRCm39) probably benign Het
Rgl2 T A 17: 34,154,133 (GRCm39) probably null Het
Rnf217 T C 10: 31,393,453 (GRCm39) D376G probably damaging Het
Septin9 C T 11: 117,250,286 (GRCm39) L519F probably damaging Het
Slc15a5 C T 6: 137,995,087 (GRCm39) C386Y possibly damaging Het
Srrm4 T A 5: 116,591,772 (GRCm39) I256F unknown Het
Stab1 G T 14: 30,874,557 (GRCm39) D950E probably benign Het
Stim2 A G 5: 54,275,825 (GRCm39) T667A probably benign Het
Strbp A T 2: 37,525,539 (GRCm39) N144K probably benign Het
Sync A G 4: 129,187,190 (GRCm39) Y74C probably benign Het
Terb1 A T 8: 105,195,380 (GRCm39) M587K possibly damaging Het
Tgfbi T C 13: 56,786,523 (GRCm39) probably benign Het
Tmf1 A T 6: 97,152,956 (GRCm39) N372K probably benign Het
Ubr4 G T 4: 139,206,887 (GRCm39) probably null Het
Uggt1 A T 1: 36,197,224 (GRCm39) N1226K probably benign Het
Ugt2b34 T C 5: 87,054,560 (GRCm39) I74V possibly damaging Het
Wdfy3 A G 5: 102,017,917 (GRCm39) L2541P probably damaging Het
Zfhx3 T G 8: 109,675,840 (GRCm39) F2297V probably damaging Het
Other mutations in Kpnb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01284:Kpnb1 APN 11 97,056,928 (GRCm39) missense probably damaging 1.00
IGL01919:Kpnb1 APN 11 97,055,556 (GRCm39) missense probably benign
IGL02161:Kpnb1 APN 11 97,059,762 (GRCm39) missense probably benign 0.01
IGL02679:Kpnb1 APN 11 97,068,086 (GRCm39) missense possibly damaging 0.92
IGL02866:Kpnb1 APN 11 97,068,112 (GRCm39) missense probably damaging 0.99
IGL02899:Kpnb1 APN 11 97,066,612 (GRCm39) missense probably damaging 1.00
R0373:Kpnb1 UTSW 11 97,075,916 (GRCm39) missense probably damaging 1.00
R0542:Kpnb1 UTSW 11 97,078,398 (GRCm39) missense probably benign 0.12
R0724:Kpnb1 UTSW 11 97,069,130 (GRCm39) missense probably damaging 1.00
R0853:Kpnb1 UTSW 11 97,078,237 (GRCm39) missense probably damaging 0.97
R1481:Kpnb1 UTSW 11 97,069,136 (GRCm39) missense probably damaging 1.00
R3802:Kpnb1 UTSW 11 97,056,955 (GRCm39) missense possibly damaging 0.92
R4458:Kpnb1 UTSW 11 97,059,996 (GRCm39) missense probably damaging 1.00
R4490:Kpnb1 UTSW 11 97,062,424 (GRCm39) missense probably benign
R4757:Kpnb1 UTSW 11 97,068,160 (GRCm39) missense possibly damaging 0.65
R5500:Kpnb1 UTSW 11 97,063,937 (GRCm39) missense possibly damaging 0.94
R6360:Kpnb1 UTSW 11 97,064,096 (GRCm39) missense probably benign
R6494:Kpnb1 UTSW 11 97,072,474 (GRCm39) missense probably benign 0.04
R7678:Kpnb1 UTSW 11 97,059,999 (GRCm39) missense probably damaging 1.00
R8171:Kpnb1 UTSW 11 97,066,573 (GRCm39) critical splice donor site probably null
R8874:Kpnb1 UTSW 11 97,056,209 (GRCm39) missense probably benign 0.25
R9318:Kpnb1 UTSW 11 97,054,284 (GRCm39) missense probably benign
R9621:Kpnb1 UTSW 11 97,058,460 (GRCm39) missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- ACACCTCCTAATGGCTCGGACAAG -3'
(R):5'- TGTCAGGATAGAAGCCAGTGCCAC -3'

Sequencing Primer
(F):5'- GGACAAGCTCCTGCCTTC -3'
(R):5'- actcaggctggcatcaaac -3'
Posted On 2013-10-16