Incidental Mutation 'R0865:Vmn2r71'
ID82301
Institutional Source Beutler Lab
Gene Symbol Vmn2r71
Ensembl Gene ENSMUSG00000091205
Gene Namevomeronasal 2, receptor 71
SynonymsEG233445
MMRRC Submission 039039-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.097) question?
Stock #R0865 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location85574614-85624547 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 85619308 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 240 (I240F)
Ref Sequence ENSEMBL: ENSMUSP00000132337 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000172338]
Predicted Effect probably benign
Transcript: ENSMUST00000172338
AA Change: I240F

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000132337
Gene: ENSMUSG00000091205
AA Change: I240F

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 77 468 2.1e-31 PFAM
Pfam:NCD3G 511 563 8.7e-20 PFAM
Pfam:7tm_3 593 831 2e-55 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208273
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208545
Meta Mutation Damage Score 0.0768 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 99.0%
  • 10x: 97.5%
  • 20x: 95.2%
Validation Efficiency 98% (53/54)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adck5 A G 15: 76,595,643 E581G probably damaging Het
Adcy5 A G 16: 35,274,471 N666S probably damaging Het
Apcs T C 1: 172,894,215 D188G probably benign Het
Arih2 A G 9: 108,649,300 probably benign Het
AU040320 A G 4: 126,848,884 K981E possibly damaging Het
Brwd1 A T 16: 96,068,584 I81K probably damaging Het
Cacng8 T A 7: 3,412,109 I136N possibly damaging Het
Ccdc114 A G 7: 45,942,088 T259A probably benign Het
Cdh22 A T 2: 165,181,056 W32R probably damaging Het
Cel A G 2: 28,560,615 S133P probably damaging Het
Clasp2 A G 9: 113,911,500 T495A possibly damaging Het
Clock A T 5: 76,266,424 probably benign Het
Cox6a2 A G 7: 128,205,823 probably benign Het
Cyp2b19 C A 7: 26,762,229 probably benign Het
Dnah11 G A 12: 118,190,844 Q234* probably null Het
Gga3 A T 11: 115,592,459 N91K probably damaging Het
Idh1 T C 1: 65,161,156 T350A probably benign Het
Ints11 A G 4: 155,887,107 probably null Het
Itgb1 A G 8: 128,710,251 probably null Het
Kank4 A T 4: 98,774,663 probably benign Het
Kansl1 A T 11: 104,424,368 D281E probably benign Het
Kmt2a T C 9: 44,818,770 probably benign Het
Kpna4 T C 3: 69,101,417 E145G probably damaging Het
Lacc1 A G 14: 77,034,144 I201T possibly damaging Het
Larp7 T C 3: 127,544,235 K392E probably damaging Het
Lbh T A 17: 72,921,229 M23K probably benign Het
Myo15 A T 11: 60,491,688 E361V probably damaging Het
Ncor2 A G 5: 125,038,982 S470P probably benign Het
Ngef T A 1: 87,484,601 M449L probably benign Het
Olfr18 T A 9: 20,314,749 Y57F probably damaging Het
Olfr322 T C 11: 58,665,652 I31T possibly damaging Het
Peak1 A T 9: 56,257,832 D937E probably benign Het
Pnpla7 A G 2: 24,982,123 K72E probably benign Het
Ptprn T G 1: 75,248,138 probably null Het
Scgn C T 13: 23,962,119 probably null Het
Sdk2 T C 11: 113,850,922 I824V probably benign Het
Slc38a3 A G 9: 107,655,648 S326P probably damaging Het
Spen A G 4: 141,471,870 S3126P probably benign Het
Tbcd T C 11: 121,602,989 C902R possibly damaging Het
Tmem63b T C 17: 45,661,519 I721V probably benign Het
Trim30c A G 7: 104,390,451 S46P probably damaging Het
Trim59 T C 3: 69,037,608 D133G probably damaging Het
Trpm7 A T 2: 126,799,239 probably null Het
Ttll10 A G 4: 156,043,678 L391P probably damaging Het
Ttn T C 2: 76,793,241 T15331A possibly damaging Het
Vmn1r237 C T 17: 21,314,714 T233I probably damaging Het
Vmn2r115 A T 17: 23,346,408 D423V possibly damaging Het
Vmn2r25 T A 6: 123,853,017 R58S probably benign Het
Wdr3 A G 3: 100,152,796 probably benign Het
Zc3h14 T C 12: 98,779,269 probably null Het
Zc3hav1 C T 6: 38,353,902 probably benign Het
Zfp335 A T 2: 164,899,495 probably null Het
Other mutations in Vmn2r71
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00922:Vmn2r71 APN 7 85618693 missense probably benign
IGL00960:Vmn2r71 APN 7 85624374 missense probably damaging 1.00
IGL01372:Vmn2r71 APN 7 85620814 splice site probably benign
IGL01690:Vmn2r71 APN 7 85615574 missense probably damaging 1.00
IGL01909:Vmn2r71 APN 7 85620793 missense probably benign 0.00
IGL01950:Vmn2r71 APN 7 85615619 missense probably damaging 0.98
IGL02570:Vmn2r71 APN 7 85615540 missense possibly damaging 0.95
IGL02650:Vmn2r71 APN 7 85624327 missense probably damaging 1.00
IGL02901:Vmn2r71 APN 7 85619262 missense probably benign 0.00
IGL03128:Vmn2r71 APN 7 85619587 missense probably damaging 1.00
IGL03328:Vmn2r71 APN 7 85624291 missense probably damaging 1.00
R0533:Vmn2r71 UTSW 7 85619218 frame shift probably null
R0707:Vmn2r71 UTSW 7 85619432 missense probably benign
R0841:Vmn2r71 UTSW 7 85618541 missense possibly damaging 0.62
R0883:Vmn2r71 UTSW 7 85623634 missense probably benign 0.19
R0939:Vmn2r71 UTSW 7 85623681 missense possibly damaging 0.70
R1597:Vmn2r71 UTSW 7 85624144 missense possibly damaging 0.46
R1646:Vmn2r71 UTSW 7 85621268 missense probably damaging 0.99
R1719:Vmn2r71 UTSW 7 85621227 missense probably damaging 1.00
R1860:Vmn2r71 UTSW 7 85615574 missense probably damaging 1.00
R2013:Vmn2r71 UTSW 7 85620637 missense probably benign 0.38
R2014:Vmn2r71 UTSW 7 85620637 missense probably benign 0.38
R2015:Vmn2r71 UTSW 7 85620637 missense probably benign 0.38
R2050:Vmn2r71 UTSW 7 85624473 missense probably damaging 1.00
R2084:Vmn2r71 UTSW 7 85618737 missense probably benign 0.03
R2221:Vmn2r71 UTSW 7 85624093 missense probably benign 0.40
R2223:Vmn2r71 UTSW 7 85624093 missense probably benign 0.40
R2245:Vmn2r71 UTSW 7 85624180 missense probably damaging 1.00
R3115:Vmn2r71 UTSW 7 85623658 missense probably damaging 0.97
R3122:Vmn2r71 UTSW 7 85615620 nonsense probably null
R3609:Vmn2r71 UTSW 7 85619662 missense probably damaging 1.00
R4093:Vmn2r71 UTSW 7 85621234 missense probably benign 0.00
R4305:Vmn2r71 UTSW 7 85624152 missense probably damaging 1.00
R4306:Vmn2r71 UTSW 7 85624152 missense probably damaging 1.00
R4334:Vmn2r71 UTSW 7 85619834 missense probably benign 0.01
R4569:Vmn2r71 UTSW 7 85624194 missense possibly damaging 0.66
R4622:Vmn2r71 UTSW 7 85620609 missense probably benign 0.00
R4915:Vmn2r71 UTSW 7 85621268 missense probably damaging 0.99
R4956:Vmn2r71 UTSW 7 85619228 missense probably benign 0.19
R5005:Vmn2r71 UTSW 7 85624144 missense probably damaging 1.00
R5045:Vmn2r71 UTSW 7 85624389 missense probably benign 0.00
R5153:Vmn2r71 UTSW 7 85619222 missense possibly damaging 0.94
R5236:Vmn2r71 UTSW 7 85623669 missense probably damaging 1.00
R5373:Vmn2r71 UTSW 7 85618542 missense possibly damaging 0.79
R5405:Vmn2r71 UTSW 7 85619414 missense probably benign
R5831:Vmn2r71 UTSW 7 85623714 missense probably benign 0.16
R6061:Vmn2r71 UTSW 7 85619274 missense probably benign
R6518:Vmn2r71 UTSW 7 85621228 missense probably damaging 1.00
R6751:Vmn2r71 UTSW 7 85619887 critical splice donor site probably null
R6920:Vmn2r71 UTSW 7 85623900 missense probably damaging 1.00
R7358:Vmn2r71 UTSW 7 85624260 missense possibly damaging 0.81
R7453:Vmn2r71 UTSW 7 85624089 missense probably benign 0.21
R7560:Vmn2r71 UTSW 7 85623907 missense probably benign 0.06
X0025:Vmn2r71 UTSW 7 85618665 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCATACATGGGCATGGGAGACATAAGT -3'
(R):5'- ACCACAGTTTGGCAAAGGAAAATTCAC -3'

Sequencing Primer
(F):5'- CATCTTCTTCTGAGTGATAAAGGAC -3'
(R):5'- CAAAACCAGGTATTTCAGGTTGC -3'
Posted On2013-11-08