Incidental Mutation 'R0865:Kank4'
ID82289
Institutional Source Beutler Lab
Gene Symbol Kank4
Ensembl Gene ENSMUSG00000035407
Gene NameKN motif and ankyrin repeat domains 4
SynonymsAnkrd38
MMRRC Submission 039039-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R0865 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location98754898-98817537 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 98774663 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000099851 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102790]
Predicted Effect probably benign
Transcript: ENSMUST00000102790
SMART Domains Protein: ENSMUSP00000099851
Gene: ENSMUSG00000035407

DomainStartEndE-ValueType
Pfam:KN_motif 24 62 5.6e-26 PFAM
low complexity region 280 295 N/A INTRINSIC
low complexity region 300 320 N/A INTRINSIC
coiled coil region 345 409 N/A INTRINSIC
low complexity region 505 521 N/A INTRINSIC
low complexity region 600 624 N/A INTRINSIC
low complexity region 625 655 N/A INTRINSIC
low complexity region 685 709 N/A INTRINSIC
ANK 838 868 7.42e-4 SMART
ANK 877 905 2.08e3 SMART
ANK 910 939 1.11e-2 SMART
ANK 943 973 8.99e-3 SMART
ANK 977 1006 2.43e3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137270
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 99.0%
  • 10x: 97.5%
  • 20x: 95.2%
Validation Efficiency 98% (53/54)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adck5 A G 15: 76,595,643 E581G probably damaging Het
Adcy5 A G 16: 35,274,471 N666S probably damaging Het
Apcs T C 1: 172,894,215 D188G probably benign Het
Arih2 A G 9: 108,649,300 probably benign Het
AU040320 A G 4: 126,848,884 K981E possibly damaging Het
Brwd1 A T 16: 96,068,584 I81K probably damaging Het
Cacng8 T A 7: 3,412,109 I136N possibly damaging Het
Ccdc114 A G 7: 45,942,088 T259A probably benign Het
Cdh22 A T 2: 165,181,056 W32R probably damaging Het
Cel A G 2: 28,560,615 S133P probably damaging Het
Clasp2 A G 9: 113,911,500 T495A possibly damaging Het
Clock A T 5: 76,266,424 probably benign Het
Cox6a2 A G 7: 128,205,823 probably benign Het
Cyp2b19 C A 7: 26,762,229 probably benign Het
Dnah11 G A 12: 118,190,844 Q234* probably null Het
Gga3 A T 11: 115,592,459 N91K probably damaging Het
Idh1 T C 1: 65,161,156 T350A probably benign Het
Ints11 A G 4: 155,887,107 probably null Het
Itgb1 A G 8: 128,710,251 probably null Het
Kansl1 A T 11: 104,424,368 D281E probably benign Het
Kmt2a T C 9: 44,818,770 probably benign Het
Kpna4 T C 3: 69,101,417 E145G probably damaging Het
Lacc1 A G 14: 77,034,144 I201T possibly damaging Het
Larp7 T C 3: 127,544,235 K392E probably damaging Het
Lbh T A 17: 72,921,229 M23K probably benign Het
Myo15 A T 11: 60,491,688 E361V probably damaging Het
Ncor2 A G 5: 125,038,982 S470P probably benign Het
Ngef T A 1: 87,484,601 M449L probably benign Het
Olfr18 T A 9: 20,314,749 Y57F probably damaging Het
Olfr322 T C 11: 58,665,652 I31T possibly damaging Het
Peak1 A T 9: 56,257,832 D937E probably benign Het
Pnpla7 A G 2: 24,982,123 K72E probably benign Het
Ptprn T G 1: 75,248,138 probably null Het
Scgn C T 13: 23,962,119 probably null Het
Sdk2 T C 11: 113,850,922 I824V probably benign Het
Slc38a3 A G 9: 107,655,648 S326P probably damaging Het
Spen A G 4: 141,471,870 S3126P probably benign Het
Tbcd T C 11: 121,602,989 C902R possibly damaging Het
Tmem63b T C 17: 45,661,519 I721V probably benign Het
Trim30c A G 7: 104,390,451 S46P probably damaging Het
Trim59 T C 3: 69,037,608 D133G probably damaging Het
Trpm7 A T 2: 126,799,239 probably null Het
Ttll10 A G 4: 156,043,678 L391P probably damaging Het
Ttn T C 2: 76,793,241 T15331A possibly damaging Het
Vmn1r237 C T 17: 21,314,714 T233I probably damaging Het
Vmn2r115 A T 17: 23,346,408 D423V possibly damaging Het
Vmn2r25 T A 6: 123,853,017 R58S probably benign Het
Vmn2r71 A T 7: 85,619,308 I240F probably benign Het
Wdr3 A G 3: 100,152,796 probably benign Het
Zc3h14 T C 12: 98,779,269 probably null Het
Zc3hav1 C T 6: 38,353,902 probably benign Het
Zfp335 A T 2: 164,899,495 probably null Het
Other mutations in Kank4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01069:Kank4 APN 4 98778395 missense probably damaging 0.99
IGL02634:Kank4 APN 4 98778827 missense probably benign 0.06
IGL02883:Kank4 APN 4 98773453 missense possibly damaging 0.87
R0040:Kank4 UTSW 4 98779220 missense probably benign 0.03
R0040:Kank4 UTSW 4 98779220 missense probably benign 0.03
R0081:Kank4 UTSW 4 98778330 missense probably benign 0.02
R0219:Kank4 UTSW 4 98778465 missense probably benign 0.06
R0498:Kank4 UTSW 4 98779636 missense probably benign
R0609:Kank4 UTSW 4 98777105 missense probably damaging 0.99
R0855:Kank4 UTSW 4 98771444 missense probably damaging 1.00
R0961:Kank4 UTSW 4 98756519 missense probably benign 0.02
R1172:Kank4 UTSW 4 98765569 missense probably damaging 1.00
R1173:Kank4 UTSW 4 98765569 missense probably damaging 1.00
R1175:Kank4 UTSW 4 98765569 missense probably damaging 1.00
R1381:Kank4 UTSW 4 98779938 missense probably damaging 0.98
R1517:Kank4 UTSW 4 98779029 missense possibly damaging 0.83
R1573:Kank4 UTSW 4 98774836 nonsense probably null
R1668:Kank4 UTSW 4 98778896 missense probably damaging 0.98
R2051:Kank4 UTSW 4 98780102 missense probably damaging 0.99
R2253:Kank4 UTSW 4 98779226 missense probably damaging 0.99
R2656:Kank4 UTSW 4 98778957 missense probably damaging 0.99
R3801:Kank4 UTSW 4 98780133 missense probably damaging 0.97
R3802:Kank4 UTSW 4 98780133 missense probably damaging 0.97
R3804:Kank4 UTSW 4 98780133 missense probably damaging 0.97
R3945:Kank4 UTSW 4 98771280 missense probably damaging 1.00
R4172:Kank4 UTSW 4 98779121 missense probably damaging 1.00
R4502:Kank4 UTSW 4 98777098 missense possibly damaging 0.89
R4503:Kank4 UTSW 4 98777098 missense possibly damaging 0.89
R5024:Kank4 UTSW 4 98785661 missense probably damaging 0.99
R5105:Kank4 UTSW 4 98779159 missense probably benign 0.01
R5122:Kank4 UTSW 4 98756567 missense probably damaging 1.00
R5255:Kank4 UTSW 4 98778972 missense probably benign
R5484:Kank4 UTSW 4 98774785 missense probably benign
R5517:Kank4 UTSW 4 98774881 missense probably damaging 1.00
R5550:Kank4 UTSW 4 98771441 missense probably benign 0.27
R5667:Kank4 UTSW 4 98765461 critical splice donor site probably null
R5671:Kank4 UTSW 4 98765461 critical splice donor site probably null
R5865:Kank4 UTSW 4 98771393 missense possibly damaging 0.50
R6176:Kank4 UTSW 4 98765554 missense probably damaging 1.00
R6778:Kank4 UTSW 4 98761505 missense probably benign 0.01
R7084:Kank4 UTSW 4 98771345 missense probably damaging 1.00
R7085:Kank4 UTSW 4 98779946 missense probably benign
R7112:Kank4 UTSW 4 98761521 missense probably damaging 0.99
R8307:Kank4 UTSW 4 98778678 nonsense probably null
R8431:Kank4 UTSW 4 98779272 missense probably benign 0.33
R8447:Kank4 UTSW 4 98778492 missense probably damaging 0.99
R8483:Kank4 UTSW 4 98771378 missense probably damaging 1.00
R8505:Kank4 UTSW 4 98785676 start gained probably benign
X0027:Kank4 UTSW 4 98779923 missense probably benign 0.00
Z1176:Kank4 UTSW 4 98778294 frame shift probably null
Predicted Primers PCR Primer
(F):5'- AGACCCTGATGGTCCAAGTATGGAG -3'
(R):5'- TCCCCTGAGGATTTGTCTGACAGTG -3'

Sequencing Primer
(F):5'- ggcatcatctcatctcccaac -3'
(R):5'- AGGATTTGTCTGACAGTGAGACC -3'
Posted On2013-11-08