Phenotypic Mutation 'Cpg6'

• Allele: Cpg6
• Mutation Type: missense
• Chromosome: 9
• Coordinate: 106,226,593 bp (GRCm38)
• Base Change: G ⇒ A (forward strand)
• Gene: Tlr9
• Gene Name: toll-like receptor 9
• Chromosomal Location: 106,222,598-106,226,883 bp (+)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the Toll-like receptor (TLR) family which plays a fundamental role in pathogen recognition and activation of innate immunity. TLRs are highly conserved from Drosophila to humans and share structural and functional similarities. They recognize pathogen-associated molecular patterns (PAMPs) that are expressed on infectious agents, and mediate the production of cytokines necessary for the development of effective immunity. The various TLRs exhibit different patterns of expression. This gene is preferentially expressed in immune cell rich tissues, such as spleen, lymph node, bone marrow and peripheral blood leukocytes. Studies in mice and human indicate that this receptor mediates cellular response to unmethylated CpG dinucleotides in bacterial DNA to mount an innate immune response. [provided by RefSeq, Jul 2008] ; PHENOTYPE: Nullizygous mice exhibit impaired immune responses to CpG DNA and altered susceptibility to EAE and parasitic infection. ENU-induced mutants may exhibit altered susceptibility to viral infection or induced colitis and impaired immune response to unmethylated CpG oligonucleotides. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Glycine changed to Arginine
• Institutional Source: Beutler Lab
• Gene Model: not available
• AlphaFold: Q9EQU3
• PDB Structure: Crystal structure of mouse TLR9 (unliganded form) [X-RAY DIFFRACTION] ; Crystal structure of mouse TLR9 in complex with inhibitory DNA4084 (form 1) [X-RAY DIFFRACTION] ; Crystal structure of mouse TLR9 in complex with inhibitory DNA4084 (form 2) [X-RAY DIFFRACTION] ; Crystal structure of mouse TLR9 in complex with inhibitory DNA_super [X-RAY DIFFRACTION] ; Crystal Structure of the C-terminal Domain of Mouse TLR9 [X-RAY DIFFRACTION]
• SMART Domains: Protein: ENSMUSP00000082207; Gene: ENSMUSG00000045322; AA Change: G1028R

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
LRR	62	85	1.49e2	SMART
LRR	122	144	1.41e1	SMART
LRR	198	221	4.98e-1	SMART
LRR	283	306	6.59e1	SMART
LRR	307	332	1.62e1	SMART
Blast:LRR	333	361	8e-6	BLAST
LRR	390	413	7.38e1	SMART
LRR	414	440	1.86e2	SMART
LRR	496	520	1.81e2	SMART
LRR	521	544	6.05e0	SMART
LRR	545	568	2.27e2	SMART
LRR	575	599	4.58e1	SMART
LRR	628	651	3.87e1	SMART
LRR_TYP	677	700	3.39e-3	SMART
LRR	702	724	2.27e2	SMART
LRR	726	748	3.09e2	SMART
Blast:LRRCT	761	810	4e-11	BLAST
Pfam:TIR	870	1029	7.4e-11	PFAM

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000062241)
• Meta Mutation Damage Score: Not available
• Is this an essential gene?: Probably nonessential (E-score: 0.117)
• Phenotypic Category: Autosomal Semidominant
• Penetrance: 100%
• Mode of Inheritance: Autosomal Semidominant
• Local Stock: Sperm, gDNA
• MMRRC Submission: 031078-UCD
• Last Updated: 2016-05-13 3:09 PM by Peter Jurek
• Record Created: unknown
• Record Posted: 2009-04-30
• Science Writers: Nora G. Smart
• Illustrators: Diantha La Vine
• Authors: Amanda L. Blasius, Bruce Beutler

Accession Number

NCBI RefSeq: NM_031178; MGI: 1932389

Alleles Listed at MGI

All alleles(9) : Targeted, knock-out(1) Gene trapped(1) Chemically induced(7)

Phenotypic Description

The CpG6 phenotype was identified in a screen of ENU-mutagenized mice looking for reduced type I interferon (IFN) responses to CpG DNA challenge in vivo (Figure 1) (1).  Macrophages from CpG6 mice do not produce tumor necrosis factor (TNF)-α in response to CpG oligonucleotides, although responses to other TLR ligands are normal (TLR Signaling Screen).

Nature of Mutation

The Tlr9 gene was directly sequenced and a mutation corresponding to a G to A transition was found at position 3188 of the Tlr9 transcript, in exon 2 of 2 total exons.

 

3173 CAGAACTTCTGCCGGGGACCTACAGCAGAATAG

1023 -Q--N--F--C--R--G--P--T--A--E--*-

 

The mutated nucleotide is indicated in red lettering, and causes a glycine to arginine substitution at amino acid 1028 of the TLR9 protein.

Protein Prediction

Figure 2. Protein and domain structure of TLR9. (A) Schematic representation of TLR9 based on crystalized structures of mouse TLR9 LRR (PBD 3WPF) and human TLR2 TIR (1FYW) domains. The residue affected by the CpG6 mutation is highlighted. 3D image was created using UCSF Chimera. (B) TLR9 is a 1032 amino acid protein with an extracellur domain (pink) of leucine rich repeats (LRR), a short transmembrane (TM) domain (blue) and a cytoplasmic Toll/Interleukin-1 receptor (TIR) domain (green). The CpG6 mutation (red asterisk) results in a glycine to arginine substitution at amino acid 1028 of the TLR9 protein. This image is interactive. Click on the image to view other mutations found in TLR9. Click on each mutation for more specific information.

The CpG6 mutation results in a glycine to arginine change at position 1028 of the TLR9 protein.  According to the crystal structure for the related TLR2 protein, this lies in the αE helix of the TIR domain.  The position of the mutation is shown in Figure 2. The mutation within the TIR domain is also shown in Figure 3 along with the position of the amino acid change caused by the CpG2 mutation (PDB ID 1FYW; see the record for languid).

 

Please see the record for CpG1 for information about Tlr9.

Putative Mechanism

The CpG6 mutation replaces a glycine possibly located in the αE helix of TLR9 with an arginine, and results in a hypomorphic allele that fails to respond to CpG ODN stimulation.  It is likely the substitution of a charged amino acid for a glycine at this position disrupts helical formation as the previous amino acid is also charged.  Many of the α-helices and connecting loops of the TIR domain are predicted to participate in binding partner recognition, and their mutation is expected to abrogate specific binding interactions.  TIR domains in TLRs, IL receptors and the adapters MyD88 and TIRAP contain 3 conserved boxes (boxes 1, 2 and 3) required for signaling, which form part of the βA-strand, BB loop and αE-helix, respectively (2;3).  Computational docking of the TLR2 TIR domain with the TIR domain of the myeloid differentiation (MyD)-88 adaptor protein suggests that TIR domains can interact in two different modes, one of which is mediated by αE-helix interactions.  Further studies of the MyD88/TLR2 αE-helical interactions suggest that the αE-helices mediate homotypic oligomerization of TIR domains (4).  Thus, the CpG6 mutation likely prevents TLR9 dimerization.  It must be noted that the amino acid sequence identity between any pair of TIR domains is generally about 25%, and that the crystal structures of different TIR domains reveal that significant conformational differences exist between them (5;6).  As the crystal structure of TLR9 has not been determined, it remains to be seen whether the TLR9 TIR domain behaves similarly to the TIR domain of TLR2.

Primers

Primers cannot be located by automatic search.

Genotyping

CpG6 genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide change. 

 

Primers for PCR amplification

CpG6(F): 5’- CAGTTCTAGACGTGAGAAGCAACCC -3’

CpG6 (R): 5’- GGCAGAGAATGAACTCCAGTCCTG -3’

 

PCR program

1) 94°C             2:00

2) 94°C             0:15

3) 56°C             0:30

4) 72°C             1:00

5) repeat steps (2-4) 35X

6) 72°C             10:00

7) 4°C               ∞

 

Primers for sequencing

CpG6_seq(F): 5’- GGAGCCGCAAGACTCTATTTG -3’

CpG6_seq(R): 5’- TCACTCTCCTGAAAGATGCATGG -3’

 

The following sequence of 1076 nucleotides (from Genbank genomic region NC_000075 for linear DNA sequence of Tlr9) is amplified:

 

3175                                                            cagttc

3181 tagacgtgag aagcaaccct ctgcactgtg cctgtggggc agccttcgta gacttactgt

3241 tggaggtgca gaccaaggtg cctggcctgg ctaatggtgt gaagtgtggc agccccggcc

3301 agctgcaggg ccgtagcatc ttcgcgcagg acctgcggct gtgcctggat gaggtcctct

3361 cttgggactg ctttggcctt tcactcttgg ctgtggccgt gggcatggtg gtgcctatac

3421 tgcaccatct ctgcggctgg gacgtctggt actgttttca tctgtgcctg gcatggctac

3481 ctttgctagc ccgcagccga cgcagcgccc aaactctccc ttatgatgcc ttcgtggtgt

3541 tcgataaggc acagagcgca gttgccgact gggtgtataa cgagctgcgg gtgcggctgg

3601 aggagcggcg cggccgccga gccctacgct tgtgtctgga ggaccgagat tggctgcctg

3661 gccagacgct cttcgagaac ctctgggctt ccatctatgg gagccgcaag actctatttg

3721 tgctggccca cacggaccgc gtcagtggcc tcctgcgcac cagcttcctg ctggctcagc

3781 agcgcctgtt ggaagaccgc aaggacgtgg tggtgttggt gatcctgcgt ccggatgccc

3841 accgctcccg ctatgtgcga ctgcgccagc gtctctgccg ccagagtgtg ctcttctggc

3901 cccagcagcc caacgggcag gggggcttct gggcccagct gagtacagcc ctgactaggg

3961 acaaccgcca cttctataac cagaacttct gccggggacc tacagcagaa tagctcagag

4021 caacagctgg aaacagctgc atcttcatgt ctggttcccg agttgctctg cctgccttgc

4081 tctgtcttac tacaccgcta tttggcaagt gcgcaatata tgctaccaag ccaccaggcc

4141 cacggagcaa aggttggctg taaagggtag ttttcttccc atgcatcttt caggagagtg

4201 aagatagaca ccaaacccac acagaacagg actggagttc attctctgcc

 

PCR primer binding sites are underlined; sequencing primer binding sites are highlighted in gray; the mutated G is shown in red text.

References

   1. Blasius, A. L., Arnold, C. N., Georgel, P., Rutschmann, S., Xia, Y., Lin, P., Ross, C., Li, X., Smart, N. G., and Beutler, B. (2010) Slc15a4, AP-3, and Hermansky-Pudlak Syndrome Proteins are Required for Toll-Like Receptor Signaling in Plasmacytoid Dendritic Cells. Proc. Natl. Acad. Sci. U. S. A.. epub Nov. 2. 

   2.  Slack, J. L., Schooley, K., Bonnert, T. P., Mitcham, J. L., Qwarnstrom, E. E., Sims, J. E., and Dower, S. K. (2000) Identification of two major sites in the type I interleukin-1 receptor cytoplasmic region responsible for coupling to pro-inflammatory signaling pathways, J. Biol. Chem. 275, 4670-4678.

   3.  Li, C., Zienkiewicz, J., and Hawiger, J. (2005) Interactive sites in the MyD88 Toll/interleukin (IL) 1 receptor domain responsible for coupling to the IL1beta signaling pathway, J. Biol. Chem. 280, 26152-26159. 

   4. Jiang, Z., Georgel, P., Li, C., Choe, J., Crozat, K., Rutschmann, S., Du, X., Bigby, T., Mudd, S., Sovath, S., Wilson, I. A., Olson, A., and Beutler, B. (2006) Details of Toll-like receptor:adapter interaction revealed by germ-line mutagenesis, Proc Natl Acad Sci U S A 103, 10961-10966.

   5.  Xu, Y., Tao, X., Shen, B., Horng, T., Medzhitov, R., Manley, J. L., and Tong, L. (2000) Structural basis for signal transduction by the Toll/interleukin-1 receptor domains, Nature 408, 111-115.

   6.  Khan, J. A., Brint, E. K., O'Neill, L. A., and Tong, L. (2004) Crystal structure of the Toll/interleukin-1 receptor domain of human IL-1RAPL, J. Biol. Chem. 279, 31664-31670.