Incidental Mutation 'R9221:Tlr9'
ID 699474
Institutional Source Beutler Lab
Gene Symbol Tlr9
Ensembl Gene ENSMUSG00000045322
Gene Name toll-like receptor 9
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.141) question?
Stock # R9221 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 106222598-106226883 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 106224773 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 421 (D421G)
Ref Sequence ENSEMBL: ENSMUSP00000082207 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062241]
AlphaFold Q9EQU3
PDB Structure Crystal structure of mouse TLR9 (unliganded form) [X-RAY DIFFRACTION]
Crystal structure of mouse TLR9 in complex with inhibitory DNA4084 (form 1) [X-RAY DIFFRACTION]
Crystal structure of mouse TLR9 in complex with inhibitory DNA4084 (form 2) [X-RAY DIFFRACTION]
Crystal structure of mouse TLR9 in complex with inhibitory DNA_super [X-RAY DIFFRACTION]
Crystal Structure of the C-terminal Domain of Mouse TLR9 [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000062241
AA Change: D421G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000082207
Gene: ENSMUSG00000045322
AA Change: D421G

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
LRR 62 85 1.49e2 SMART
LRR 122 144 1.41e1 SMART
LRR 198 221 4.98e-1 SMART
LRR 283 306 6.59e1 SMART
LRR 307 332 1.62e1 SMART
Blast:LRR 333 361 8e-6 BLAST
LRR 390 413 7.38e1 SMART
LRR 414 440 1.86e2 SMART
LRR 496 520 1.81e2 SMART
LRR 521 544 6.05e0 SMART
LRR 545 568 2.27e2 SMART
LRR 575 599 4.58e1 SMART
LRR 628 651 3.87e1 SMART
LRR_TYP 677 700 3.39e-3 SMART
LRR 702 724 2.27e2 SMART
LRR 726 748 3.09e2 SMART
Blast:LRRCT 761 810 4e-11 BLAST
Pfam:TIR 870 1029 7.4e-11 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the Toll-like receptor (TLR) family which plays a fundamental role in pathogen recognition and activation of innate immunity. TLRs are highly conserved from Drosophila to humans and share structural and functional similarities. They recognize pathogen-associated molecular patterns (PAMPs) that are expressed on infectious agents, and mediate the production of cytokines necessary for the development of effective immunity. The various TLRs exhibit different patterns of expression. This gene is preferentially expressed in immune cell rich tissues, such as spleen, lymph node, bone marrow and peripheral blood leukocytes. Studies in mice and human indicate that this receptor mediates cellular response to unmethylated CpG dinucleotides in bacterial DNA to mount an innate immune response. [provided by RefSeq, Jul 2008]
PHENOTYPE: Nullizygous mice exhibit impaired immune responses to CpG DNA and altered susceptibility to EAE and parasitic infection. ENU-induced mutants may exhibit altered susceptibility to viral infection or induced colitis and impaired immune response to unmethylated CpG oligonucleotides. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610528A11Rik A G 14: 37,107,395 S44P probably damaging Het
2810403A07Rik T C 3: 88,686,546 S81P probably benign Het
Abca4 A G 3: 122,128,179 D1128G probably damaging Het
Acsm3 A T 7: 119,768,908 R116* probably null Het
Ahnak T A 19: 9,012,579 D3742E probably damaging Het
Arhgef17 A G 7: 100,879,611 S598P possibly damaging Het
Asxl2 T C 12: 3,502,310 F1351L probably damaging Het
Atg7 C T 6: 114,695,627 T267I possibly damaging Het
Bace2 A G 16: 97,408,492 K202R probably benign Het
Bccip G T 7: 133,709,520 V55L probably benign Het
Bpifa1 T A 2: 154,146,132 H198Q possibly damaging Het
Btbd7 A G 12: 102,811,171 Y466H probably damaging Het
Cdc45 A C 16: 18,786,771 S480A probably benign Het
Cenpe T C 3: 135,230,078 Y425H possibly damaging Het
Cep76 A C 18: 67,634,907 M185R probably damaging Het
Chd5 G T 4: 152,371,665 M930I probably damaging Het
Clstn2 G T 9: 97,461,342 T684K probably benign Het
Col4a2 A G 8: 11,441,943 N1270S possibly damaging Het
Crxos A G 7: 15,902,925 H141R probably benign Het
Dcc A G 18: 71,420,362 I741T possibly damaging Het
Ddx20 A T 3: 105,680,369 C430* probably null Het
Dgki G A 6: 37,296,680 T12M probably benign Het
Dock6 T C 9: 21,809,857 N1676S possibly damaging Het
Exosc6 G A 8: 111,056,396 R9H probably damaging Het
Fstl5 A G 3: 76,661,807 Q589R probably damaging Het
Gm4846 T A 1: 166,497,390 Y44F probably benign Het
Gm498 G T 7: 143,881,165 probably null Het
Gtf3c2 A C 5: 31,169,057 I370R probably damaging Het
Hjurp CTCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCT C 1: 88,266,277 probably benign Het
Hspg2 A G 4: 137,560,415 M3696V possibly damaging Het
Itga1 A T 13: 115,030,159 C167* probably null Het
Kpna2 A G 11: 106,989,332 S497P probably damaging Het
Krt77 T A 15: 101,865,629 T197S probably damaging Het
Krtap6-5 T C 16: 89,047,767 Y26C unknown Het
Lhfpl5 A T 17: 28,580,159 D214V possibly damaging Het
Lrrtm1 A G 6: 77,244,613 E351G probably damaging Het
Mphosph9 A G 5: 124,265,364 V867A probably benign Het
Mtcl1 T A 17: 66,343,884 M1529L probably benign Het
Mthfr A T 4: 148,048,169 Q268L probably damaging Het
Myo1d A T 11: 80,674,918 N360K probably damaging Het
Nbea AC A 3: 56,090,972 probably null Het
Olfr1028 T A 2: 85,951,841 Y259* probably null Het
Olfr1208 T C 2: 88,896,911 S229G probably benign Het
Olfr1437 A T 19: 12,321,972 M285K probably damaging Het
Olfr393 A T 11: 73,847,282 V281E probably damaging Het
P2rx5 A T 11: 73,171,829 T455S probably damaging Het
Palld A T 8: 61,516,557 F1244L unknown Het
Pbld1 A G 10: 63,072,050 T125A Het
Pde3b G A 7: 114,415,462 probably benign Het
Pfkm T C 15: 98,121,307 S180P probably damaging Het
Pla2g4d T A 2: 120,269,972 R626S possibly damaging Het
Postn A G 3: 54,375,094 E492G possibly damaging Het
Prph2 A G 17: 46,919,892 D237G probably damaging Het
Psmd4 T C 3: 95,035,293 H105R probably damaging Het
Pygl T C 12: 70,195,627 N685S probably damaging Het
Rp1 A G 1: 4,245,043 F502S unknown Het
Sik1 T C 17: 31,847,193 I607V probably benign Het
Slc26a3 T A 12: 31,463,471 I464N possibly damaging Het
Slc38a9 A G 13: 112,689,376 N116S probably damaging Het
Sorcs2 C A 5: 36,024,566 probably null Het
Spink5 T C 18: 43,986,300 L226P probably damaging Het
Tab1 G A 15: 80,150,553 V180I probably benign Het
Tacc2 T G 7: 130,624,328 S914R probably damaging Het
Tacc2 C T 7: 130,624,479 R965C probably benign Het
Tmem181a T C 17: 6,256,990 L16P probably damaging Het
Trim58 A T 11: 58,651,249 H345L probably damaging Het
Ttc13 G A 8: 124,673,551 R688C probably benign Het
Ube2o C A 11: 116,542,838 V685L probably damaging Het
Uso1 A G 5: 92,187,314 H511R probably benign Het
Vmn2r5 A T 3: 64,504,300 Y282* probably null Het
Other mutations in Tlr9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00864:Tlr9 APN 9 106225007 missense probably damaging 1.00
IGL01764:Tlr9 APN 9 106225805 missense probably damaging 1.00
IGL02077:Tlr9 APN 9 106225505 missense possibly damaging 0.90
IGL02232:Tlr9 APN 9 106224937 missense probably damaging 1.00
IGL02851:Tlr9 APN 9 106224730 nonsense probably null
Asura UTSW 9 106224647 missense probably damaging 1.00
Cpg1 UTSW 9 106225007 missense probably damaging 1.00
Cpg11 UTSW 9 106224586 missense probably damaging 1.00
Cpg2 UTSW 9 106226465 missense probably damaging 1.00
Cpg3 UTSW 9 106224152 missense probably damaging 1.00
Cpg5 UTSW 9 106224689 missense probably damaging 1.00
Cpg6 UTSW 9 106226593 missense probably damaging 1.00
cpg7 UTSW 9 106225349 missense probably benign 0.00
Meager UTSW 9 106224139 missense probably damaging 1.00
PIT4498001:Tlr9 UTSW 9 106223522 missense probably benign 0.00
R0058:Tlr9 UTSW 9 106224965 missense possibly damaging 0.90
R0058:Tlr9 UTSW 9 106224965 missense possibly damaging 0.90
R0071:Tlr9 UTSW 9 106223578 missense probably benign
R0071:Tlr9 UTSW 9 106223578 missense probably benign
R0126:Tlr9 UTSW 9 106225682 missense probably benign 0.01
R0165:Tlr9 UTSW 9 106226087 missense probably benign 0.10
R0534:Tlr9 UTSW 9 106224887 missense probably benign 0.01
R0585:Tlr9 UTSW 9 106225076 missense probably benign 0.01
R1527:Tlr9 UTSW 9 106223750 missense probably benign 0.09
R1712:Tlr9 UTSW 9 106224049 missense probably damaging 1.00
R1817:Tlr9 UTSW 9 106224943 missense probably benign
R1940:Tlr9 UTSW 9 106224647 missense probably damaging 1.00
R2117:Tlr9 UTSW 9 106225337 missense probably damaging 1.00
R2656:Tlr9 UTSW 9 106223941 missense probably benign 0.05
R3700:Tlr9 UTSW 9 106224079 missense probably damaging 1.00
R4600:Tlr9 UTSW 9 106224533 missense probably damaging 1.00
R4608:Tlr9 UTSW 9 106224974 missense probably damaging 0.99
R4612:Tlr9 UTSW 9 106223807 missense probably damaging 1.00
R4959:Tlr9 UTSW 9 106224677 missense probably benign
R5173:Tlr9 UTSW 9 106225952 missense possibly damaging 0.49
R5472:Tlr9 UTSW 9 106224313 missense probably damaging 1.00
R5572:Tlr9 UTSW 9 106225637 missense possibly damaging 0.47
R5618:Tlr9 UTSW 9 106224739 missense possibly damaging 0.47
R5820:Tlr9 UTSW 9 106222707 critical splice donor site probably null
R6393:Tlr9 UTSW 9 106224937 missense probably damaging 1.00
R6397:Tlr9 UTSW 9 106225106 missense probably damaging 1.00
R6455:Tlr9 UTSW 9 106223999 missense probably damaging 1.00
R7385:Tlr9 UTSW 9 106225264 missense probably damaging 1.00
R7455:Tlr9 UTSW 9 106224530 missense probably benign 0.00
R7561:Tlr9 UTSW 9 106225949 missense probably benign 0.00
R8889:Tlr9 UTSW 9 106222635 start gained probably benign
R8892:Tlr9 UTSW 9 106222635 start gained probably benign
R8926:Tlr9 UTSW 9 106226014 missense probably benign
R9228:Tlr9 UTSW 9 106225553 missense possibly damaging 0.49
Z1176:Tlr9 UTSW 9 106223663 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- AGAAGGTATCCTTTGCCCGC -3'
(R):5'- AGGTCCATGGTGAACTTGAAG -3'

Sequencing Primer
(F):5'- TAAGAACCTGGTGTCACTGC -3'
(R):5'- GAAGTTCTTACACCTGTCCATGAAG -3'
Posted On 2022-02-07