Incidental Mutation 'R7455:Tlr9'
ID 578081
Institutional Source Beutler Lab
Gene Symbol Tlr9
Ensembl Gene ENSMUSG00000045322
Gene Name toll-like receptor 9
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.095) question?
Stock # R7455 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 106222598-106226883 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 106224530 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 340 (N340S)
Ref Sequence ENSEMBL: ENSMUSP00000082207 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062241]
AlphaFold Q9EQU3
PDB Structure Crystal structure of mouse TLR9 (unliganded form) [X-RAY DIFFRACTION]
Crystal structure of mouse TLR9 in complex with inhibitory DNA4084 (form 1) [X-RAY DIFFRACTION]
Crystal structure of mouse TLR9 in complex with inhibitory DNA4084 (form 2) [X-RAY DIFFRACTION]
Crystal structure of mouse TLR9 in complex with inhibitory DNA_super [X-RAY DIFFRACTION]
Crystal Structure of the C-terminal Domain of Mouse TLR9 [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000062241
AA Change: N340S

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000082207
Gene: ENSMUSG00000045322
AA Change: N340S

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
LRR 62 85 1.49e2 SMART
LRR 122 144 1.41e1 SMART
LRR 198 221 4.98e-1 SMART
LRR 283 306 6.59e1 SMART
LRR 307 332 1.62e1 SMART
Blast:LRR 333 361 8e-6 BLAST
LRR 390 413 7.38e1 SMART
LRR 414 440 1.86e2 SMART
LRR 496 520 1.81e2 SMART
LRR 521 544 6.05e0 SMART
LRR 545 568 2.27e2 SMART
LRR 575 599 4.58e1 SMART
LRR 628 651 3.87e1 SMART
LRR_TYP 677 700 3.39e-3 SMART
LRR 702 724 2.27e2 SMART
LRR 726 748 3.09e2 SMART
Blast:LRRCT 761 810 4e-11 BLAST
Pfam:TIR 870 1029 7.4e-11 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the Toll-like receptor (TLR) family which plays a fundamental role in pathogen recognition and activation of innate immunity. TLRs are highly conserved from Drosophila to humans and share structural and functional similarities. They recognize pathogen-associated molecular patterns (PAMPs) that are expressed on infectious agents, and mediate the production of cytokines necessary for the development of effective immunity. The various TLRs exhibit different patterns of expression. This gene is preferentially expressed in immune cell rich tissues, such as spleen, lymph node, bone marrow and peripheral blood leukocytes. Studies in mice and human indicate that this receptor mediates cellular response to unmethylated CpG dinucleotides in bacterial DNA to mount an innate immune response. [provided by RefSeq, Jul 2008]
PHENOTYPE: Nullizygous mice exhibit impaired immune responses to CpG DNA and altered susceptibility to EAE and parasitic infection. ENU-induced mutants may exhibit altered susceptibility to viral infection or induced colitis and impaired immune response to unmethylated CpG oligonucleotides. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agbl1 C T 7: 76,424,755 H646Y unknown Het
Ak5 C T 3: 152,481,572 R426H probably damaging Het
Akap9 T C 5: 3,972,792 V1207A probably benign Het
Asph A T 4: 9,531,732 probably null Het
Avpr1a T G 10: 122,449,264 C154G probably damaging Het
Boll T C 1: 55,300,103 Q283R probably benign Het
Cad C T 5: 31,074,162 P1743S probably damaging Het
Ccdc137 T G 11: 120,460,159 M129R probably damaging Het
Cdh23 A G 10: 60,306,224 I3028T possibly damaging Het
Cep68 T A 11: 20,230,571 I687F probably damaging Het
Ces2a T A 8: 104,737,522 I262N probably damaging Het
Cfap44 A G 16: 44,404,784 probably benign Het
Cfap69 T G 5: 5,625,873 H247P possibly damaging Het
Cideb T C 14: 55,754,835 T134A probably damaging Het
Cilp2 A T 8: 69,881,071 D1092E probably damaging Het
Cptp G A 4: 155,866,500 R170C probably damaging Het
Cysrt1 A G 2: 25,239,410 L30S probably benign Het
Dcc A G 18: 71,420,323 V754A probably benign Het
Fam189a1 A G 7: 64,759,413 V411A probably benign Het
Fer1l5 A T 1: 36,388,983 T453S probably benign Het
Fnbp4 ACCACCTCCACCTCCACCTCC ACCACCTCCACCTCCACCTCCACCTCC 2: 90,777,815 probably benign Het
Frem2 C T 3: 53,572,280 probably null Het
Gm13941 A G 2: 111,094,740 F173L unknown Het
Greb1l G A 18: 10,554,915 A1654T probably damaging Het
Inpp4b T A 8: 82,071,703 I840N probably damaging Het
Kdm4b T A 17: 56,396,657 I746N probably damaging Het
Lins1 C A 7: 66,711,944 H448N probably benign Het
Ly9 A T 1: 171,593,939 Y581* probably null Het
Mark1 T A 1: 184,919,750 E186V probably damaging Het
Mcph1 T A 8: 18,631,759 V304E probably benign Het
Mical3 T C 6: 120,958,744 D1607G probably damaging Het
Mup18 A G 4: 61,673,934 V31A probably benign Het
Nectin3 A T 16: 46,496,742 C11* probably null Het
Nedd1 A T 10: 92,700,925 L172M probably benign Het
Nim1k G A 13: 119,712,459 R300W probably damaging Het
Olfr1220 G T 2: 89,097,090 P279Q probably damaging Het
Olfr143 T C 9: 38,254,254 V276A probably damaging Het
Olfr834 A G 9: 18,988,854 I289V possibly damaging Het
Oprm1 T C 10: 6,830,204 F289L probably damaging Het
Parg T C 14: 32,209,475 Y351H probably benign Het
Phf3 A C 1: 30,837,158 V118G probably damaging Het
Pik3c2g T C 6: 139,967,917 Y1014H unknown Het
Pmp22 A G 11: 63,134,513 probably null Het
Ppfibp1 T A 6: 147,016,350 F501L probably damaging Het
Rgl2 G A 17: 33,932,683 A234T probably benign Het
Rhpn2 G A 7: 35,371,244 probably null Het
Ryr3 T C 2: 112,728,866 K3058E probably damaging Het
Sbsn A T 7: 30,753,177 Q539L possibly damaging Het
Scgn G A 13: 23,966,865 R168C probably benign Het
Serpinb10 A G 1: 107,536,102 Y38C probably damaging Het
Sfmbt2 G A 2: 10,577,955 V709I probably benign Het
Slc1a2 A T 2: 102,735,954 M10L probably benign Het
Sox6 T G 7: 115,489,669 I653L probably benign Het
Tespa1 A G 10: 130,360,690 I166V probably benign Het
Tex15 T C 8: 33,576,997 Y2152H possibly damaging Het
Tmem198 G A 1: 75,479,786 R28Q unknown Het
Vmn2r7 T C 3: 64,716,593 D102G probably benign Het
Wdr93 A G 7: 79,775,519 M529V probably benign Het
Zcchc6 T C 13: 59,822,057 Y8C probably benign Het
Zfp110 A G 7: 12,848,057 H310R probably benign Het
Zfp36l2 A G 17: 84,187,147 S21P probably damaging Het
Zfp534 G A 4: 147,674,755 H486Y probably damaging Het
Zfp638 G A 6: 83,930,145 V431I probably damaging Het
Other mutations in Tlr9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00864:Tlr9 APN 9 106225007 missense probably damaging 1.00
IGL01764:Tlr9 APN 9 106225805 missense probably damaging 1.00
IGL02077:Tlr9 APN 9 106225505 missense possibly damaging 0.90
IGL02232:Tlr9 APN 9 106224937 missense probably damaging 1.00
IGL02851:Tlr9 APN 9 106224730 nonsense probably null
Asura UTSW 9 106224647 missense probably damaging 1.00
Cpg1 UTSW 9 106225007 missense probably damaging 1.00
Cpg11 UTSW 9 106224586 missense probably damaging 1.00
Cpg2 UTSW 9 106226465 missense probably damaging 1.00
Cpg3 UTSW 9 106224152 missense probably damaging 1.00
Cpg5 UTSW 9 106224689 missense probably damaging 1.00
Cpg6 UTSW 9 106226593 missense probably damaging 1.00
cpg7 UTSW 9 106225349 missense probably benign 0.00
Meager UTSW 9 106224139 missense probably damaging 1.00
PIT4498001:Tlr9 UTSW 9 106223522 missense probably benign 0.00
R0058:Tlr9 UTSW 9 106224965 missense possibly damaging 0.90
R0058:Tlr9 UTSW 9 106224965 missense possibly damaging 0.90
R0071:Tlr9 UTSW 9 106223578 missense probably benign
R0071:Tlr9 UTSW 9 106223578 missense probably benign
R0126:Tlr9 UTSW 9 106225682 missense probably benign 0.01
R0165:Tlr9 UTSW 9 106226087 missense probably benign 0.10
R0534:Tlr9 UTSW 9 106224887 missense probably benign 0.01
R0585:Tlr9 UTSW 9 106225076 missense probably benign 0.01
R1527:Tlr9 UTSW 9 106223750 missense probably benign 0.09
R1712:Tlr9 UTSW 9 106224049 missense probably damaging 1.00
R1817:Tlr9 UTSW 9 106224943 missense probably benign
R1940:Tlr9 UTSW 9 106224647 missense probably damaging 1.00
R2117:Tlr9 UTSW 9 106225337 missense probably damaging 1.00
R2656:Tlr9 UTSW 9 106223941 missense probably benign 0.05
R3700:Tlr9 UTSW 9 106224079 missense probably damaging 1.00
R4600:Tlr9 UTSW 9 106224533 missense probably damaging 1.00
R4608:Tlr9 UTSW 9 106224974 missense probably damaging 0.99
R4612:Tlr9 UTSW 9 106223807 missense probably damaging 1.00
R4959:Tlr9 UTSW 9 106224677 missense probably benign
R5173:Tlr9 UTSW 9 106225952 missense possibly damaging 0.49
R5472:Tlr9 UTSW 9 106224313 missense probably damaging 1.00
R5572:Tlr9 UTSW 9 106225637 missense possibly damaging 0.47
R5618:Tlr9 UTSW 9 106224739 missense possibly damaging 0.47
R5820:Tlr9 UTSW 9 106222707 critical splice donor site probably null
R6393:Tlr9 UTSW 9 106224937 missense probably damaging 1.00
R6397:Tlr9 UTSW 9 106225106 missense probably damaging 1.00
R6455:Tlr9 UTSW 9 106223999 missense probably damaging 1.00
R7385:Tlr9 UTSW 9 106225264 missense probably damaging 1.00
R7561:Tlr9 UTSW 9 106225949 missense probably benign 0.00
R8889:Tlr9 UTSW 9 106222635 start gained probably benign
R8892:Tlr9 UTSW 9 106222635 start gained probably benign
R8926:Tlr9 UTSW 9 106226014 missense probably benign
R9221:Tlr9 UTSW 9 106224773 missense probably damaging 1.00
R9228:Tlr9 UTSW 9 106225553 missense possibly damaging 0.49
Z1176:Tlr9 UTSW 9 106223663 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- ATCACCTGAGCCATCTGGAAG -3'
(R):5'- TCGGAAGGTACCAAAGATGCTG -3'

Sequencing Primer
(F):5'- TGAGCCATCTGGAAGGCCTG -3'
(R):5'- TACCAAAGATGCTGAGCTGTGC -3'
Posted On 2019-10-07