Phenotypic Mutation 'gut_check'

• Allele: gut_check
• Mutation Type: nonsense
• Chromosome: 6
• Coordinate: 85,620,369 bp (GRCm38)
• Base Change: A ⇒ T (forward strand)
• Gene: Alms1
• Gene Name: ALMS1, centrosome and basal body associated
• Chromosomal Location: 85,587,531-85,702,753 bp (+)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing a large tandem-repeat domain as well as additional low complexity regions. The encoded protein functions in microtubule organization, particularly in the formation and maintanance of cilia. Mutations in this gene cause Alstrom syndrome. There is a pseudogene for this gene located adjacent in the same region of chromosome 2. Alternative splice variants have been described but their full length nature has not been determined. [provided by RefSeq, Apr 2014] ; PHENOTYPE: Homozygous null mice display obesity starting after puberty, hypogonadism, hyperinsulinemia, male-specific hyperglycemia, retinal dysfunction, and late-onset hearing loss. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Arginine changed to Stop codon
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000071904] [ENSMUSP00000148796]
• AlphaFold: no structure available at present
• SMART Domains: Protein: ENSMUSP00000071904; Gene: ENSMUSG00000063810; AA Change: R726*

Domain	Start	End	E-Value	Type
coiled coil region	10	39	N/A	INTRINSIC
low complexity region	67	80	N/A	INTRINSIC
low complexity region	98	119	N/A	INTRINSIC
Blast:MYSc	127	233	1e-21	BLAST
internal_repeat_3	408	511	2.48e-7	PROSPERO
internal_repeat_2	414	804	2.09e-12	PROSPERO
internal_repeat_1	438	834	4.54e-18	PROSPERO
internal_repeat_3	652	757	2.48e-7	PROSPERO
low complexity region	903	908	N/A	INTRINSIC
internal_repeat_1	916	1385	4.54e-18	PROSPERO
internal_repeat_2	1024	1390	2.09e-12	PROSPERO
low complexity region	1572	1586	N/A	INTRINSIC
low complexity region	2004	2017	N/A	INTRINSIC
low complexity region	2760	2773	N/A	INTRINSIC
low complexity region	2950	2968	N/A	INTRINSIC
low complexity region	3013	3030	N/A	INTRINSIC
Pfam:ALMS_motif	3125	3247	1.8e-42	PFAM

• Predicted Effect: probably null
• Predicted Effect: probably null
• Meta Mutation Damage Score: 0.9755
• Is this an essential gene?: Non Essential (E-score: 0.000)
• Phenotypic Category: Unknown
• Mode of Inheritance: Unknown
• Last Updated: 2021-11-17 4:12 PM by Diantha La Vine
• Record Created: 2019-05-18 12:41 PM by Bruce Beutler
• Record Posted: 2019-05-22
• Science Writers: Anne Murray
• Illustrators: Diantha La Vine
• Authors: Emre Turer, Zhao Zhang, and Bruce Beutler

Accession Number

NCBI RefSeq: NM_145223; MGI:1934606

Alleles Listed at MGI

All Mutations and Alleles(21) : Chemically induced (ENU)(8) Gene trapped(9) Spontaneous(2) Targeted(2)

Phenotypic Description

Figure 1. Gut_check mice exhibited increased body weights compared to wild-type littermates . Scaled weights are shown. Abbreviations: REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The gut_check phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R0110, some of which showed increased body weights compared to wild-type littermates (Figure 1).

Nature of Mutation

Figure 2. Linkage mapping of the increased body weight using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 100 mutations (X-axis) identified in the G1 male of pedigree R0110. Weight data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 100 mutations. The body weight phenotype was linked to mutations in several genes. However, the mutation in Alms1 was presumed causative as the body weight phenotype in the gut_check mice resembles that of mice expressing other mutant ALMS1 alleles (see MGI). The mutation in Alms1 is an A to T transversion at base pair 85,620,369 (v38) on chromosome 6, or base pair 32,871 in the GenBank genomic region NC_000072 encoding Alms1. Linkage was found with a recessive model of inheritance, wherein two variant homozygotes departed phenotypically from two homozygous reference mice and three heterozygous mice with a P value of 0.000143 (Figure 2).  

The mutation corresponds to residue 2,291 in the NM_145223 mRNA sequence in exon 8 of 23 total exons. 

2276 TACTCATATAAAGGGAGACCCAATAGTTCTTAT 721  -Y--S--Y--K--G--R--P--N--S--S--Y-

The mutated nucleotide is indicated in red. The mutation results in substitution of arginine 726 for a premature stop codon (R726*) in the ALMS1 protein (Figure 3).

Protein Prediction

Alms1 encodes Alström Syndrome 1 (ALMS1), which has a glutamine-rich segment (amino acids 2-80), a proline-rich segment (amino acids 90-113), a putative leucine zipper (amino acids), a large tandem repeat domain (TRD) comprised of 34 imperfect repeats of a 45-50-amino acid sequence (amino acids 440−1362), a histidine-rich region (amino acids 2582-2618), two putative nuclear localization signals, a serine-rich region, and an ALMS motif (amino acids 3124-3251) [Figure 3; (1-4)]. The functional significance of the domains of ALMS1 is unknown. 

The gut_check mutation results in substitution of arginine 726 for a premature stop codon (R726*) in the ALMS1 protein; residue 726 is within the TRD.

For more information about Alms1, please see the record for ares.

Putative Mechanism

ALMS1 has putative roles in cell cycle regulation, cell migration, apoptosis, extracellular matrix production, ciliary assembly and/or function, adipogenesis, cytoplasmic microtubular organization, endosomal transport, and regulation of the transport of proteins between the cytoplasm and the ciliary axoneme (4-8). ALMS1 is proposed to be involved in intracellular trafficking of one or more uncharacterized receptors to the primary cilium membrane. ALMS1 may be involved in vesicle transport from the Golgi to the cilium and/or in intraflagellar transport. When ALMS1 is present, signals from the transported receptor regulate cellular homeostasis, neurogenesis, or organ function. In the absence of ALMS1, the receptor(s) are not transported within the cilia, resulting in defective signaling. In the absence of ALMS1 there is obesity, neurosensory deficit, and organ failure.

Homozygous or compound heterozygous mutations in ALMS1 that typically result in coding of a premature stop codon and coding of a truncated protein are linked to Alström syndrome (OMIM: #203800; (2;9)]. Alström syndrome has variable symptoms including childhood obesity due to an excess accumulation of subcutaneous adipose tissue, hyperinsulinemia, acanthosis nigricans (a marker of severe insulin resistance), type 2 diabetes mellitus, hypertriglyceridemia that can lead to acute pancreatitis, hypothyroidsism, growth hormone deficiency, sensorineural hearing loss, and progressive rod-cone dystrophy leading to blindness [(10); reviewed in (11;12)].

Several Alms1 mutant mouse models (fat aussie (foz), Alms1^L2131X, and Alms1^-/-) have been characterized (13-15). All of the mouse models exhibited rapid weight gain due to an increase in body fat and increased eating at weaning. In addition, all of the mutant Alms1 alleles also resulted in hyperinsulinemia, increased cholesterol levels (total and HDL), moderate late-onset (after ~16 weeks) diabetes only in the male mice, steatosis of the liver, hyperplastic pancreatic islets, and hypogonadism leading to infertility in the male mice. The phenotype of the gut_check mice indicate loss of ALMS1-associated function.

Primers

PCR Primer
gut_check_pcr_F: TTTTCTATCAGCAGGGGTTGCCAG
gut_check_pcr_R: TGCAGATCCTCTTCAGACAGACCAC

Sequencing Primer
gut_check_seq_F: TTGCCAGATAGGCATTCAGC
gut_check_seq_R: CACCATCTGGCAGGGTTTG

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 469 nucleotides is amplified (chromosome 6, + strand):

1   ttttctatca gcaggggttg ccagataggc attcagcaaa aagccctaca aaaaccttta
61  tcccaggacc agctgaccag aagactgatc tatcaccagt accccctact tcctcttcgc
121 atgcagagaa gcctgtttcc ccctaccagt taaccttgcc aggtagtcat ctacctgaag
181 atgttttcaa agcttcttct gtttgtaagt catctgatga gctatctgga ataacagctc
241 taacctctgc ttcctactca tataaaggga gacccaatag ttcttatcag cagaagtttc
301 cagacagcca cctaaatgaa gaggcccaga aaatcttggg tacaactgga acagtagacc
361 agaagacagt gacaccaaca atgtcttctt cctttttaca aaaagaaaag cctagtattt
421 tctaccaaca aaccctgcca gatggtggtc tgtctgaaga ggatctgca

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

  1. Knorz, V. J., Spalluto, C., Lessard, M., Purvis, T. L., Adigun, F. F., Collin, G. B., Hanley, N. A., Wilson, D. I., and Hearn, T. (2010) Centriolar Association of ALMS1 and Likely Centrosomal Functions of the ALMS Motif-Containing Proteins C10orf90 and KIAA1731. Mol Biol Cell. 21, 3617-3629.

  2. Collin, G. B., Marshall, J. D., Ikeda, A., So, W. V., Russell-Eggitt, I., Maffei, P., Beck, S., Boerkoel, C. F., Sicolo, N., Martin, M., Nishina, P. M., and Naggert, J. K. (2002) Mutations in ALMS1 Cause Obesity, Type 2 Diabetes and Neurosensory Degeneration in Alstrom Syndrome. Nat Genet. 31, 74-78.

  3. Hearn, T., Renforth, G. L., Spalluto, C., Hanley, N. A., Piper, K., Brickwood, S., White, C., Connolly, V., Taylor, J. F., Russell-Eggitt, I., Bonneau, D., Walker, M., and Wilson, D. I. (2002) Mutation of ALMS1, a Large Gene with a Tandem Repeat Encoding 47 Amino Acids, Causes Alstrom Syndrome. Nat Genet. 31, 79-83.

  4. Hearn, T., Spalluto, C., Phillips, V. J., Renforth, G. L., Copin, N., Hanley, N. A., and Wilson, D. I. (2005) Subcellular Localization of ALMS1 Supports Involvement of Centrosome and Basal Body Dysfunction in the Pathogenesis of Obesity, Insulin Resistance, and Type 2 Diabetes. Diabetes. 54, 1581-1587.

  5. Jagger, D., Collin, G., Kelly, J., Towers, E., Nevill, G., Longo-Guess, C., Benson, J., Halsey, K., Dolan, D., Marshall, J., Naggert, J., and Forge, A. (2011) Alstrom Syndrome Protein ALMS1 Localizes to Basal Bodies of Cochlear Hair Cells and Regulates Cilium-Dependent Planar Cell Polarity. Hum Mol Genet. 20, 466-481.

  6. Collin, G. B., Cyr, E., Bronson, R., Marshall, J. D., Gifford, E. J., Hicks, W., Murray, S. A., Zheng, Q. Y., Smith, R. S., Nishina, P. M., and Naggert, J. K. (2005) Alms1-Disrupted Mice Recapitulate Human Alstrom Syndrome. Hum Mol Genet. 14, 2323-2333.

  7. Andersen, J. S., Wilkinson, C. J., Mayor, T., Mortensen, P., Nigg, E. A., and Mann, M. (2003) Proteomic Characterization of the Human Centrosome by Protein Correlation Profiling. Nature. 426, 570-574.

  8. Li, G., Vega, R., Nelms, K., Gekakis, N., Goodnow, C., McNamara, P., Wu, H., Hong, N. A., and Glynne, R. (2007) A Role for Alstrom Syndrome Protein, alms1, in Kidney Ciliogenesis and Cellular Quiescence. PLoS Genet. 3, e8.

  9. Joy, T., Cao, H., Black, G., Malik, R., Charlton-Menys, V., Hegele, R. A., and Durrington, P. N. (2007) Alstrom Syndrome (OMIM 203800): A Case Report and Literature Review. Orphanet J Rare Dis. 2, 49.

  10. Marshall, J. D., Bronson, R. T., Collin, G. B., Nordstrom, A. D., Maffei, P., Paisey, R. B., Carey, C., Macdermott, S., Russell-Eggitt, I., Shea, S. E., Davis, J., Beck, S., Shatirishvili, G., Mihai, C. M., Hoeltzenbein, M., Pozzan, G. B., Hopkinson, I., Sicolo, N., Naggert, J. K., and Nishina, P. M. (2005) New Alstrom Syndrome Phenotypes Based on the Evaluation of 182 Cases. Arch Intern Med. 165, 675-683.

  11. Marshall, J. D., Beck, S., Maffei, P., and Naggert, J. K. (2007) Alstrom Syndrome. Eur J Hum Genet. 15, 1193-1202.

  12. Girard, D., and Petrovsky, N. (2011) Alstrom Syndrome: Insights into the Pathogenesis of Metabolic Disorders. Nat Rev Endocrinol. 7, 77-88.

  13. Arsov, T., Silva, D. G., O'Bryan, M. K., Sainsbury, A., Lee, N. J., Kennedy, C., Manji, S. S., Nelms, K., Liu, C., Vinuesa, C. G., de Kretser, D. M., Goodnow, C. C., and Petrovsky, N. (2006) Fat Aussie--a New Alstrom Syndrome Mouse Showing a Critical Role for ALMS1 in Obesity, Diabetes, and Spermatogenesis. Mol Endocrinol. 20, 1610-1622.

  14. Favaretto, F., Milan, G., Collin, G. B., Marshall, J. D., Stasi, F., Maffei, P., Vettor, R., and Naggert, J. K. (2014) GLUT4 Defects in Adipose Tissue are Early Signs of Metabolic Alterations in Alms1GT/GT, a Mouse Model for Obesity and Insulin Resistance. PLoS One. 9, e109540.

  15. Arsov, T., Larter, C. Z., Nolan, C. J., Petrovsky, N., Goodnow, C. C., Teoh, N. C., Yeh, M. M., and Farrell, G. C. (2006) Adaptive Failure to High-Fat Diet Characterizes Steatohepatitis in Alms1 Mutant Mice. Biochem Biophys Res Commun. 342, 1152-1159.