Mutagenetix > Incidental Mutation

Incidental Mutation 'R1836:Alms1'

205281

Institutional Source

Beutler Lab

Gene Symbol

Alms1

Ensembl Gene

ENSMUSG00000063810

Gene Name

ALMS1, centrosome and basal body associated

Synonyms

MMRRC Submission

039863-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1836 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

85587531-85702753 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 85678503 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Threonine at position 3344 (S3344T)

Ref Sequence

ENSEMBL: ENSMUSP00000148796 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000072018] [ENSMUST00000213058]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000072018
AA Change: S2875T

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000071904
Gene: ENSMUSG00000063810
AA Change: S2875T

Domain	Start	End	E-Value	Type
coiled coil region	10	39	N/A	INTRINSIC
low complexity region	67	80	N/A	INTRINSIC
low complexity region	98	119	N/A	INTRINSIC
Blast:MYSc	127	233	1e-21	BLAST
internal_repeat_3	408	511	2.48e-7	PROSPERO
internal_repeat_2	414	804	2.09e-12	PROSPERO
internal_repeat_1	438	834	4.54e-18	PROSPERO
internal_repeat_3	652	757	2.48e-7	PROSPERO
low complexity region	903	908	N/A	INTRINSIC
internal_repeat_1	916	1385	4.54e-18	PROSPERO
internal_repeat_2	1024	1390	2.09e-12	PROSPERO
low complexity region	1572	1586	N/A	INTRINSIC
low complexity region	2004	2017	N/A	INTRINSIC
low complexity region	2760	2773	N/A	INTRINSIC
low complexity region	2950	2968	N/A	INTRINSIC
low complexity region	3013	3030	N/A	INTRINSIC
Pfam:ALMS_motif	3125	3247	1.8e-42	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000202081

Predicted Effect

possibly damaging
Transcript: ENSMUST00000213058
AA Change: S3344T

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)

Coding Region Coverage

1x: 97.4%
3x: 96.8%
10x: 95.1%
20x: 91.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing a large tandem-repeat domain as well as additional low complexity regions. The encoded protein functions in microtubule organization, particularly in the formation and maintanance of cilia. Mutations in this gene cause Alstrom syndrome. There is a pseudogene for this gene located adjacent in the same region of chromosome 2. Alternative splice variants have been described but their full length nature has not been determined. [provided by RefSeq, Apr 2014]
PHENOTYPE: Homozygous null mice display obesity starting after puberty, hypogonadism, hyperinsulinemia, male-specific hyperglycemia, retinal dysfunction, and late-onset hearing loss. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 108 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700029P11Rik	T	C	15: 81,980,867	V103A	probably damaging	Het
2210408I21Rik	A	G	13: 77,323,374	E966G	probably benign	Het
7420426K07Rik	C	A	9: 98,903,482	R67S	probably benign	Het
9330159F19Rik	T	C	10: 29,221,799	V64A	probably damaging	Het
Abcb5	G	T	12: 118,867,961	Q1219K	possibly damaging	Het
Acox2	A	T	14: 8,248,059	C408S	possibly damaging	Het
Acsf3	T	A	8: 122,780,183	Y72N	probably damaging	Het
Acss2	T	A	2: 155,558,630	Y530N	probably damaging	Het
Adam28	T	C	14: 68,649,421	E48G	possibly damaging	Het
Adgrv1	A	C	13: 81,504,113	M2957R	probably benign	Het
Adi1	C	A	12: 28,679,563	D138E	probably benign	Het
Alk	A	C	17: 71,891,037	L1228R	probably damaging	Het
Aox2	G	A	1: 58,308,991	A623T	probably benign	Het
Arhgef2	C	T	3: 88,639,459	T545I	probably damaging	Het
Atp8a2	T	A	14: 60,006,366	N630I	possibly damaging	Het
Bcl9	G	T	3: 97,205,870	Q1090K	probably damaging	Het
Bdp1	A	G	13: 100,035,145	S2152P	probably benign	Het
Birc6	T	A	17: 74,614,390	S2155T	probably benign	Het
Camk2b	T	C	11: 5,972,384	E488G	probably damaging	Het
Capn9	T	A	8: 124,605,565		probably null	Het
Cd209f	A	G	8: 4,104,491	S119P	probably damaging	Het
Cep78	T	C	19: 15,969,169	E433G	probably damaging	Het
Chid1	G	T	7: 141,526,496		probably null	Het
Cldnd2	T	C	7: 43,442,925	S129P	possibly damaging	Het
Cobll1	A	T	2: 65,126,236	F289Y	probably damaging	Het
Creb1	C	T	1: 64,550,950	Q32*	probably null	Het
Creb3l4	G	T	3: 90,238,903	S182Y	probably benign	Het
Dgcr2	A	T	16: 17,849,720	C292S	probably damaging	Het
Dnah8	T	C	17: 30,874,927	V4665A	possibly damaging	Het
Dnah9	A	T	11: 66,118,841	M740K	probably benign	Het
Dnmt1	G	A	9: 20,918,246	T687I	probably damaging	Het
Ece1	C	T	4: 137,958,001	R601W	probably damaging	Het
Echdc2	C	A	4: 108,165,535	R3S	probably damaging	Het
Ep400	A	T	5: 110,705,054	L1275Q	unknown	Het
Epha6	A	T	16: 60,205,745	W445R	probably damaging	Het
Ercc5	T	A	1: 44,180,875	S1102R	probably benign	Het
Fam228a	T	G	12: 4,715,620	T264P	probably damaging	Het
Fzd6	T	A	15: 39,033,920	I488N	probably damaging	Het
Gabrg3	T	G	7: 56,729,641	N338H	probably damaging	Het
Gde1	A	G	7: 118,695,134	F39L	possibly damaging	Het
Gjb3	G	A	4: 127,326,431	R103W	probably damaging	Het
Gm4781	T	A	10: 100,396,720		noncoding transcript	Het
Gm4846	T	A	1: 166,483,923	T456S	probably benign	Het
Gm5415	T	G	1: 32,545,677	D384A	probably damaging	Het
Gpx5	A	G	13: 21,287,454	I193T	probably benign	Het
Herc2	A	T	7: 56,155,105	K2294*	probably null	Het
Hist1h3b	T	A	13: 23,752,732	V118D	probably damaging	Het
Iqgap3	T	A	3: 88,108,368	V19D	probably damaging	Het
Itga5	T	C	15: 103,346,014	I1006V	probably damaging	Het
Lamb1	C	T	12: 31,301,094	T781I	probably benign	Het
Lias	A	G	5: 65,392,343	T57A	probably benign	Het
Lin37	C	A	7: 30,556,943	R108L	probably damaging	Het
Lrrd1	A	T	5: 3,865,709	T769S	probably benign	Het
Mamstr	T	C	7: 45,644,963	W414R	probably damaging	Het
Mtmr11	T	G	3: 96,164,786	S233R	probably damaging	Het
Myh1	A	T	11: 67,204,822	I266F	probably damaging	Het
Myt1	C	A	2: 181,797,275	Q197K	probably benign	Het
Naip5	G	T	13: 100,219,687	T1140K	probably benign	Het
Ncf2	G	A	1: 152,808,071	V14M	probably damaging	Het
Nhsl1	G	T	10: 18,524,905	R626S	possibly damaging	Het
Nol12	T	A	15: 78,937,889	V108E	probably damaging	Het
Nr1i2	G	T	16: 38,249,282	P420Q	probably damaging	Het
Nup155	A	G	15: 8,154,980	I1286M	possibly damaging	Het
Ocrl	T	A	X: 47,962,116	I74N	probably damaging	Het
Olfr1257	A	C	2: 89,881,285	H153P	probably damaging	Het
Olfr64	A	G	7: 103,893,385	S117P	probably damaging	Het
Olfr993	A	G	2: 85,414,405	V158A	probably benign	Het
Pard3b	C	T	1: 62,637,604	S999L	probably benign	Het
Pax9	A	G	12: 56,700,054	E225G	probably benign	Het
Pdcd4	T	G	19: 53,926,219	L335R	probably damaging	Het
Pdgfra	T	A	5: 75,183,014	M732K	possibly damaging	Het
Pkhd1	G	T	1: 20,117,069	Q3672K	probably benign	Het
Pold2	A	G	11: 5,873,454	L325P	possibly damaging	Het
Pom121l2	A	T	13: 21,983,784	T742S	probably benign	Het
Ppfia1	C	T	7: 144,519,631	E208K	probably benign	Het
Prex2	A	T	1: 11,136,780	R521W	probably damaging	Het
Rhpn2	T	C	7: 35,372,388	L226P	probably benign	Het
Rps12	C	A	10: 23,785,629	D95Y	probably damaging	Het
Sardh	T	A	2: 27,215,182	D643V	possibly damaging	Het
Sars	T	C	3: 108,435,944	D77G	probably benign	Het
Scin	C	A	12: 40,124,698	V129F	probably damaging	Het
Sftpa1	T	A	14: 41,132,846	M66K	possibly damaging	Het
Sgo1	T	C	17: 53,687,771	K28E	probably damaging	Het
Sim2	G	T	16: 94,123,577		probably null	Het
Srp54b	T	A	12: 55,250,160		probably null	Het
Stard7	T	C	2: 127,295,560	V310A	probably benign	Het
Tasp1	T	C	2: 139,951,557	D233G	probably damaging	Het
Tdrd6	G	T	17: 43,625,589	L1523M	probably benign	Het
Tle3	A	G	9: 61,414,023	D639G	probably damaging	Het
Tmem128	A	G	5: 38,260,406	D2G	probably damaging	Het
Tmem163	A	G	1: 127,677,509	S41P	probably benign	Het
Ttn	C	T	2: 76,729,161	S29632N	probably damaging	Het
Tuba4a	A	G	1: 75,216,110	S287P	probably benign	Het
Ubn1	G	C	16: 5,077,391	G767A	probably benign	Het
Ugdh	A	T	5: 65,420,291	C288*	probably null	Het
Upf2	T	A	2: 6,050,324		probably null	Het
Vmn1r2	T	C	4: 3,172,836	S252P	probably damaging	Het
Vmn1r28	A	C	6: 58,265,252	T27P	probably damaging	Het
Vmn1r77	T	C	7: 12,041,411	I38T	probably benign	Het
Vmn2r51	C	A	7: 10,098,163	E499*	probably null	Het
Vmn2r51	G	T	7: 10,098,164	Y498*	probably null	Het
Vmn2r53	A	T	7: 12,600,885	W283R	probably damaging	Het
Vpreb1	T	A	16: 16,869,069	T15S	probably benign	Het
Vps13b	T	C	15: 35,910,232	S3381P	probably damaging	Het
Wnt2	A	T	6: 18,023,235	D138E	probably damaging	Het
Zdhhc22	A	G	12: 86,983,430	V248A	probably benign	Het
Zfp30	T	A	7: 29,793,380	I434N	probably damaging	Het
Zfp316	A	G	5: 143,253,423	L947P	probably damaging	Het

Other mutations in Alms1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00227:Alms1	APN	6	85677964	missense	probably damaging	1.00
IGL00331:Alms1	APN	6	85641371	missense	possibly damaging	0.94
IGL00658:Alms1	APN	6	85628961	missense	probably damaging	1.00
IGL00835:Alms1	APN	6	85622134	missense	probably damaging	1.00
IGL00930:Alms1	APN	6	85601310	missense	probably damaging	0.98
IGL01446:Alms1	APN	6	85696701	missense	probably damaging	1.00
IGL01448:Alms1	APN	6	85677899	missense	possibly damaging	0.93
IGL01563:Alms1	APN	6	85627983	missense	probably damaging	1.00
IGL01632:Alms1	APN	6	85627946	missense	probably benign	0.07
IGL01651:Alms1	APN	6	85656476	missense	probably benign	0.05
IGL01670:Alms1	APN	6	85678150	missense	probably benign	0.00
IGL01716:Alms1	APN	6	85628094	missense	probably benign	0.01
IGL01719:Alms1	APN	6	85628094	missense	probably benign	0.01
IGL01720:Alms1	APN	6	85628094	missense	probably benign	0.01
IGL01723:Alms1	APN	6	85628094	missense	probably benign	0.01
IGL01877:Alms1	APN	6	85622411	missense	possibly damaging	0.55
IGL01919:Alms1	APN	6	85628004	missense	possibly damaging	0.77
IGL01976:Alms1	APN	6	85622665	missense	possibly damaging	0.73
IGL02003:Alms1	APN	6	85622223	missense	possibly damaging	0.54
IGL02069:Alms1	APN	6	85628823	missense	probably benign	0.12
IGL02070:Alms1	APN	6	85651403	missense	possibly damaging	0.74
IGL02079:Alms1	APN	6	85628634	missense	probably damaging	0.98
IGL02081:Alms1	APN	6	85620303	missense	possibly damaging	0.55
IGL02379:Alms1	APN	6	85629633	missense	probably damaging	0.98
IGL02412:Alms1	APN	6	85628872	missense	possibly damaging	0.91
IGL02606:Alms1	APN	6	85599967	missense	probably benign
IGL02636:Alms1	APN	6	85628654	missense	probably benign	0.28
IGL02702:Alms1	APN	6	85599849	missense	probably benign	0.12
IGL02815:Alms1	APN	6	85667957	critical splice donor site	probably null
IGL02926:Alms1	APN	6	85641450	missense	probably damaging	1.00
IGL02945:Alms1	APN	6	85620933	missense	probably damaging	0.96
IGL02959:Alms1	APN	6	85629052	nonsense	probably null
IGL03124:Alms1	APN	6	85678419	missense	probably benign	0.03
IGL03199:Alms1	APN	6	85622497	missense	possibly damaging	0.68
IGL03209:Alms1	APN	6	85599973	splice site	probably benign
IGL03247:Alms1	APN	6	85678597	missense	possibly damaging	0.85
ares	UTSW	6	85621275	nonsense	probably null
ares2	UTSW	6	85677990	nonsense	probably null
butterball	UTSW	6	85696771	missense	probably damaging	0.99
earthquake	UTSW	6	85628735	nonsense	probably null
fatty	UTSW	6	85627934	nonsense	probably null
gut_check	UTSW	6	85620369	nonsense	probably null
portly	UTSW	6	85619712	missense	probably benign	0.00
replete	UTSW	6	85629208	missense	possibly damaging	0.87
PIT4468001:Alms1	UTSW	6	85624719	critical splice donor site	probably null
R0003:Alms1	UTSW	6	85629210	missense	possibly damaging	0.90
R0095:Alms1	UTSW	6	85620253	missense	possibly damaging	0.90
R0110:Alms1	UTSW	6	85620369	nonsense	probably null
R0114:Alms1	UTSW	6	85619803	missense	probably benign	0.00
R0153:Alms1	UTSW	6	85641381	missense	possibly damaging	0.94
R0217:Alms1	UTSW	6	85622930	missense	probably damaging	0.99
R0328:Alms1	UTSW	6	85610814	splice site	probably null
R0410:Alms1	UTSW	6	85587803	missense	unknown
R0469:Alms1	UTSW	6	85620369	nonsense	probably null
R0491:Alms1	UTSW	6	85702600	missense	probably damaging	0.98
R0510:Alms1	UTSW	6	85620369	nonsense	probably null
R0522:Alms1	UTSW	6	85621615	missense	probably benign
R0525:Alms1	UTSW	6	85587760	missense	unknown
R0611:Alms1	UTSW	6	85678671	missense	possibly damaging	0.61
R0637:Alms1	UTSW	6	85623033	missense	possibly damaging	0.85
R0718:Alms1	UTSW	6	85621821	missense	probably benign	0.00
R0831:Alms1	UTSW	6	85628520	missense	probably benign	0.00
R1318:Alms1	UTSW	6	85628549	missense	possibly damaging	0.62
R1340:Alms1	UTSW	6	85667957	critical splice donor site	probably null
R1561:Alms1	UTSW	6	85629052	nonsense	probably null
R1648:Alms1	UTSW	6	85678402	missense	probably damaging	0.99
R1697:Alms1	UTSW	6	85622454	missense	possibly damaging	0.94
R1699:Alms1	UTSW	6	85622880	missense	possibly damaging	0.46
R1715:Alms1	UTSW	6	85629052	nonsense	probably null
R1723:Alms1	UTSW	6	85628753	missense	probably damaging	1.00
R1734:Alms1	UTSW	6	85641550	critical splice donor site	probably null
R1758:Alms1	UTSW	6	85628505	missense	probably damaging	0.99
R1804:Alms1	UTSW	6	85621275	nonsense	probably null
R1835:Alms1	UTSW	6	85678503	missense	possibly damaging	0.94
R2077:Alms1	UTSW	6	85622309	missense	possibly damaging	0.93
R2246:Alms1	UTSW	6	85622967	missense	possibly damaging	0.91
R2254:Alms1	UTSW	6	85619848	missense	probably damaging	1.00
R2280:Alms1	UTSW	6	85677973	missense	probably damaging	0.99
R2516:Alms1	UTSW	6	85667963	splice site	probably benign
R2519:Alms1	UTSW	6	85667963	splice site	probably benign
R2566:Alms1	UTSW	6	85622482	missense	possibly damaging	0.84
R2850:Alms1	UTSW	6	85621299	missense	probably benign	0.00
R2850:Alms1	UTSW	6	85667963	splice site	probably benign
R2932:Alms1	UTSW	6	85620562	missense	possibly damaging	0.89
R2944:Alms1	UTSW	6	85628391	missense	probably damaging	1.00
R2980:Alms1	UTSW	6	85628835	missense	probably damaging	1.00
R3084:Alms1	UTSW	6	85678140	missense	probably benign
R3086:Alms1	UTSW	6	85678140	missense	probably benign
R3122:Alms1	UTSW	6	85667963	splice site	probably benign
R3404:Alms1	UTSW	6	85667963	splice site	probably benign
R3405:Alms1	UTSW	6	85667963	splice site	probably benign
R3804:Alms1	UTSW	6	85619647	missense	probably damaging	1.00
R3904:Alms1	UTSW	6	85621678	missense	probably benign	0.00
R4014:Alms1	UTSW	6	85678352	missense	probably benign	0.41
R4056:Alms1	UTSW	6	85587803	missense	unknown
R4067:Alms1	UTSW	6	85621289	missense	probably damaging	1.00
R4110:Alms1	UTSW	6	85620888	missense	probably benign	0.00
R4111:Alms1	UTSW	6	85620888	missense	probably benign	0.00
R4112:Alms1	UTSW	6	85620888	missense	probably benign	0.00
R4194:Alms1	UTSW	6	85677990	nonsense	probably null
R4464:Alms1	UTSW	6	85620021	missense	possibly damaging	0.66
R4539:Alms1	UTSW	6	85620478	missense	possibly damaging	0.78
R4554:Alms1	UTSW	6	85624617	missense	probably benign
R4696:Alms1	UTSW	6	85620522	missense	probably damaging	1.00
R4825:Alms1	UTSW	6	85678245	missense	probably damaging	0.99
R4921:Alms1	UTSW	6	85628546	missense	probably benign	0.13
R5030:Alms1	UTSW	6	85627964	missense	probably damaging	0.98
R5051:Alms1	UTSW	6	85627934	nonsense	probably null
R5085:Alms1	UTSW	6	85620732	missense	possibly damaging	0.55
R5141:Alms1	UTSW	6	85621432	missense	probably benign	0.01
R5233:Alms1	UTSW	6	85656371	splice site	probably null
R5310:Alms1	UTSW	6	85615368	missense	possibly damaging	0.79
R5344:Alms1	UTSW	6	85696789	missense	probably benign	0.04
R5394:Alms1	UTSW	6	85623088	missense	probably benign	0.01
R5460:Alms1	UTSW	6	85696731	missense	probably benign	0.08
R5558:Alms1	UTSW	6	85641329	nonsense	probably null
R5650:Alms1	UTSW	6	85620271	missense	probably damaging	1.00
R5667:Alms1	UTSW	6	85696771	missense	probably damaging	0.99
R5671:Alms1	UTSW	6	85629208	missense	possibly damaging	0.87
R5688:Alms1	UTSW	6	85599895	missense	possibly damaging	0.92
R5815:Alms1	UTSW	6	85622838	missense	probably damaging	0.99
R5892:Alms1	UTSW	6	85620903	missense	probably damaging	0.99
R5947:Alms1	UTSW	6	85619712	missense	probably benign	0.00
R6031:Alms1	UTSW	6	85622955	missense	probably damaging	1.00
R6031:Alms1	UTSW	6	85622955	missense	probably damaging	1.00
R6144:Alms1	UTSW	6	85623074	missense	probably damaging	0.98
R6258:Alms1	UTSW	6	85628735	nonsense	probably null
R6260:Alms1	UTSW	6	85628735	nonsense	probably null
R6455:Alms1	UTSW	6	85696657	missense	probably damaging	0.99
R6569:Alms1	UTSW	6	85641339	missense	probably benign	0.07
R6637:Alms1	UTSW	6	85619734	missense	possibly damaging	0.78
R6866:Alms1	UTSW	6	85621098	missense	possibly damaging	0.85
R6918:Alms1	UTSW	6	85622661	missense	possibly damaging	0.87
R7121:Alms1	UTSW	6	85624622	missense	probably damaging	1.00
R7179:Alms1	UTSW	6	85621369	missense	probably benign	0.09
R7334:Alms1	UTSW	6	85641450	missense	probably damaging	0.99
R7376:Alms1	UTSW	6	85622106	missense	probably benign	0.10
R7394:Alms1	UTSW	6	85622223	missense	possibly damaging	0.54
R7413:Alms1	UTSW	6	85628306	missense	probably benign	0.03
R7511:Alms1	UTSW	6	85609425	missense	unknown
R7542:Alms1	UTSW	6	85629362	missense	possibly damaging	0.62
R7562:Alms1	UTSW	6	85620412	missense	probably damaging	1.00
R7575:Alms1	UTSW	6	85622159	missense	possibly damaging	0.49
R7577:Alms1	UTSW	6	85615320	missense	probably benign	0.09
R7618:Alms1	UTSW	6	85678417	missense	probably benign	0.07
R7653:Alms1	UTSW	6	85620595	missense	possibly damaging	0.47
R7672:Alms1	UTSW	6	85615351	missense	probably damaging	1.00
R7807:Alms1	UTSW	6	85622976	missense	possibly damaging	0.91
R7815:Alms1	UTSW	6	85615358	missense	probably benign	0.42
R7849:Alms1	UTSW	6	85621497	missense	possibly damaging	0.48
R7944:Alms1	UTSW	6	85641380	missense	probably benign	0.03
R7954:Alms1	UTSW	6	85621162	missense	probably damaging	0.98
R7971:Alms1	UTSW	6	85628679	missense	probably benign
R8048:Alms1	UTSW	6	85641334	missense	probably benign	0.13
R8223:Alms1	UTSW	6	85643240	nonsense	probably null
R8332:Alms1	UTSW	6	85620579	missense	probably benign	0.05
R8374:Alms1	UTSW	6	85608991	missense	probably benign	0.41
R8470:Alms1	UTSW	6	85641375	missense	probably damaging	0.99
R8755:Alms1	UTSW	6	85621574	missense	probably benign	0.01
R8979:Alms1	UTSW	6	85621027	missense	probably damaging	0.98
R9044:Alms1	UTSW	6	85696753	missense	probably damaging	0.98
R9057:Alms1	UTSW	6	85609832	missense	unknown
R9224:Alms1	UTSW	6	85621788	missense	possibly damaging	0.69
R9259:Alms1	UTSW	6	85667891	missense	possibly damaging	0.94
R9401:Alms1	UTSW	6	85678019	nonsense	probably null
R9459:Alms1	UTSW	6	85627964	missense	probably damaging	0.98
R9633:Alms1	UTSW	6	85623143	missense	probably damaging	0.99
R9716:Alms1	UTSW	6	85601252	missense	possibly damaging	0.84
R9730:Alms1	UTSW	6	85629438	missense	probably benign	0.00
R9790:Alms1	UTSW	6	85619443	missense	probably benign	0.04
R9791:Alms1	UTSW	6	85619443	missense	probably benign	0.04
R9802:Alms1	UTSW	6	85629238	missense	possibly damaging	0.61
X0013:Alms1	UTSW	6	85656455	missense	probably damaging	1.00
X0025:Alms1	UTSW	6	85620210	missense	probably damaging	0.96
Z1176:Alms1	UTSW	6	85678418	missense	probably benign	0.41

Predicted Primers

PCR Primer
(F):5'- CATCCTGAGGAAAGAGCCAG -3'
(R):5'- TGTAGCCGTGTACCTGGATG -3'

Sequencing Primer
(F):5'- GAGCCAGGTTTTAATAATGTCAGC -3'
(R):5'- GCTCAGAAGTCATTTGGGGAC -3'

Posted On

2014-06-23