Phenotypic Mutation 'parker' (pdf version)
List |< first << previous [record 52 of 74] next >> last >|
Alleleparker
Mutation Type critical splice donor site (2 bp from exon)
Chromosome11
Coordinate60,520,914 bp (GRCm38)
Base Change T ⇒ C (forward strand)
Gene Myo15
Gene Name myosin XV
Synonym(s) sh2; sh-2; Myo15a
Chromosomal Location 60,469,339-60,528,369 bp (+)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an unconventional myosin. This protein differs from other myosins in that it has a long N-terminal extension preceding the conserved motor domain. Studies in mice suggest that this protein is necessary for actin organization in the hair cells of the cochlea. Mutations in this gene have been associated with profound, congenital, neurosensory, nonsyndromal deafness. This gene is located within the Smith-Magenis syndrome region on chromosome 17. Read-through transcripts containing an upstream gene and this gene have been identified, but they are not thought to encode a fusion protein. Several alternatively spliced transcript variants have been described, but their full length sequences have not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations in this gene result in profound deafness and neurological behavior. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_010862, NM_182698, NM_001103171; MGI:1261811

Mapped Yes 
Amino Acid Change
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000071777] [ENSMUSP00000080507] [ENSMUSP00000091686]
SMART Domains Protein: ENSMUSP00000071777
Gene: ENSMUSG00000042678

DomainStartEndE-ValueType
low complexity region 4 24 N/A INTRINSIC
low complexity region 87 100 N/A INTRINSIC
low complexity region 107 120 N/A INTRINSIC
low complexity region 269 292 N/A INTRINSIC
low complexity region 295 306 N/A INTRINSIC
low complexity region 311 325 N/A INTRINSIC
low complexity region 349 384 N/A INTRINSIC
low complexity region 425 435 N/A INTRINSIC
low complexity region 487 498 N/A INTRINSIC
low complexity region 502 509 N/A INTRINSIC
low complexity region 653 681 N/A INTRINSIC
low complexity region 692 705 N/A INTRINSIC
low complexity region 737 747 N/A INTRINSIC
low complexity region 758 775 N/A INTRINSIC
low complexity region 781 792 N/A INTRINSIC
low complexity region 796 809 N/A INTRINSIC
low complexity region 825 849 N/A INTRINSIC
low complexity region 883 897 N/A INTRINSIC
low complexity region 1067 1082 N/A INTRINSIC
low complexity region 1115 1130 N/A INTRINSIC
MYSc 1200 1884 N/A SMART
IQ 1885 1907 1.63e-1 SMART
IQ 1908 1930 1.77e-2 SMART
IQ 1931 1953 2.97e2 SMART
low complexity region 1955 1974 N/A INTRINSIC
low complexity region 1992 2006 N/A INTRINSIC
MyTH4 2049 2195 1.8e-42 SMART
low complexity region 2396 2405 N/A INTRINSIC
low complexity region 2451 2461 N/A INTRINSIC
Blast:MYSc 2665 2848 2e-14 BLAST
SH3 2851 2933 1.55e-4 SMART
low complexity region 2949 2962 N/A INTRINSIC
MyTH4 3031 3185 5.59e-48 SMART
B41 3188 3400 6.94e-3 SMART
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000080507
Gene: ENSMUSG00000042678

DomainStartEndE-ValueType
MYSc 13 697 N/A SMART
IQ 698 720 1.63e-1 SMART
IQ 721 743 1.77e-2 SMART
IQ 744 766 2.97e2 SMART
low complexity region 787 801 N/A INTRINSIC
MyTH4 844 990 1.8e-42 SMART
low complexity region 1191 1200 N/A INTRINSIC
low complexity region 1246 1256 N/A INTRINSIC
Blast:MYSc 1460 1643 7e-15 BLAST
SH3 1646 1728 1.55e-4 SMART
low complexity region 1744 1757 N/A INTRINSIC
MyTH4 1826 1980 5.59e-48 SMART
B41 1983 2195 6.94e-3 SMART
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000091686
Gene: ENSMUSG00000042678

DomainStartEndE-ValueType
low complexity region 4 24 N/A INTRINSIC
low complexity region 87 100 N/A INTRINSIC
low complexity region 107 120 N/A INTRINSIC
low complexity region 269 292 N/A INTRINSIC
low complexity region 295 306 N/A INTRINSIC
low complexity region 311 325 N/A INTRINSIC
low complexity region 349 384 N/A INTRINSIC
low complexity region 425 435 N/A INTRINSIC
low complexity region 487 498 N/A INTRINSIC
low complexity region 502 509 N/A INTRINSIC
low complexity region 653 681 N/A INTRINSIC
low complexity region 692 705 N/A INTRINSIC
low complexity region 737 747 N/A INTRINSIC
low complexity region 758 775 N/A INTRINSIC
low complexity region 781 792 N/A INTRINSIC
low complexity region 796 809 N/A INTRINSIC
low complexity region 825 849 N/A INTRINSIC
low complexity region 883 897 N/A INTRINSIC
low complexity region 1067 1082 N/A INTRINSIC
low complexity region 1115 1130 N/A INTRINSIC
MYSc 1200 1884 N/A SMART
IQ 1885 1907 1.63e-1 SMART
IQ 1908 1930 1.77e-2 SMART
IQ 1931 1953 2.97e2 SMART
low complexity region 1974 1988 N/A INTRINSIC
MyTH4 2031 2177 1.8e-42 SMART
low complexity region 2378 2387 N/A INTRINSIC
low complexity region 2433 2443 N/A INTRINSIC
Blast:MYSc 2647 2830 2e-14 BLAST
SH3 2833 2915 1.55e-4 SMART
low complexity region 2931 2944 N/A INTRINSIC
MyTH4 3013 3167 5.59e-48 SMART
B41 3170 3382 6.94e-3 SMART
Predicted Effect probably null
Phenotypic Category
Phenotypequestion? Literature verified References
behavior/neurological
hearing/vestibular/ear
Penetrance  
Alleles Listed at MGI

All alleles(7) : Targeted(3) Spontaneous(2) Chemically induced(1) Radiation induced(1)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00845:Myo15 APN 11 60477779 missense probably damaging 1.00
IGL01011:Myo15 APN 11 60476992 missense probably benign 0.33
IGL01100:Myo15 APN 11 60511158 missense probably damaging 1.00
IGL01357:Myo15 APN 11 60502289 splice site probably benign
IGL01634:Myo15 APN 11 60495472 missense probably damaging 1.00
IGL01763:Myo15 APN 11 60521738 missense probably benign 0.07
IGL01901:Myo15 APN 11 60527434 utr 3 prime probably benign
IGL01931:Myo15 APN 11 60496138 missense probably damaging 1.00
IGL02006:Myo15 APN 11 60511128 missense probably damaging 1.00
IGL02041:Myo15 APN 11 60506863 missense probably damaging 0.99
IGL02094:Myo15 APN 11 60510647 unclassified probably benign
IGL02122:Myo15 APN 11 60483466 missense probably benign 0.23
IGL02153:Myo15 APN 11 60498397 missense probably damaging 1.00
IGL02328:Myo15 APN 11 60526607 missense probably benign 0.13
IGL02330:Myo15 APN 11 60477161 missense possibly damaging 0.94
IGL02431:Myo15 APN 11 60510639 missense possibly damaging 0.73
IGL02639:Myo15 APN 11 60478621 missense probably benign
IGL02659:Myo15 APN 11 60491783 splice site probably benign
IGL02800:Myo15 APN 11 60502369 missense probably damaging 1.00
IGL02812:Myo15 APN 11 60477179 missense probably benign 0.15
IGL02863:Myo15 APN 11 60478127 missense probably damaging 1.00
IGL02873:Myo15 APN 11 60483482 missense probably damaging 1.00
IGL02990:Myo15 APN 11 60479440 missense probably benign 0.02
IGL03011:Myo15 APN 11 60509531 splice site probably benign
IGL03243:Myo15 APN 11 60496518 missense probably damaging 1.00
IGL03297:Myo15 APN 11 60479141 missense probably damaging 1.00
typhoon UTSW 11 60487425 critical splice donor site probably null
PIT4131001:Myo15 UTSW 11 60483127 missense probably damaging 1.00
PIT4131001:Myo15 UTSW 11 60495454 missense probably damaging 1.00
R0133:Myo15 UTSW 11 60477850 missense possibly damaging 0.94
R0265:Myo15 UTSW 11 60514897 critical splice acceptor site probably null
R0389:Myo15 UTSW 11 60478538 missense probably benign
R0416:Myo15 UTSW 11 60511174 missense probably damaging 1.00
R0449:Myo15 UTSW 11 60509596 missense possibly damaging 0.92
R0477:Myo15 UTSW 11 60520914 critical splice donor site probably null
R0543:Myo15 UTSW 11 60479051 missense probably benign
R0546:Myo15 UTSW 11 60506313 missense probably damaging 1.00
R0555:Myo15 UTSW 11 60521638 missense probably damaging 1.00
R0639:Myo15 UTSW 11 60479336 missense probably benign 0.12
R0723:Myo15 UTSW 11 60478977 missense possibly damaging 0.94
R0837:Myo15 UTSW 11 60487251 missense probably damaging 0.98
R0865:Myo15 UTSW 11 60491688 missense probably damaging 1.00
R0899:Myo15 UTSW 11 60477185 missense possibly damaging 0.87
R1022:Myo15 UTSW 11 60479616 missense probably benign 0.00
R1024:Myo15 UTSW 11 60479616 missense probably benign 0.00
R1035:Myo15 UTSW 11 60510558 unclassified probably benign
R1109:Myo15 UTSW 11 60493066 missense probably damaging 1.00
R1170:Myo15 UTSW 11 60479407 missense probably benign 0.04
R1241:Myo15 UTSW 11 60499430 missense possibly damaging 0.58
R1392:Myo15 UTSW 11 60477974 missense possibly damaging 0.95
R1392:Myo15 UTSW 11 60477974 missense possibly damaging 0.95
R1434:Myo15 UTSW 11 60504331 missense probably benign 0.00
R1450:Myo15 UTSW 11 60495482 missense probably damaging 1.00
R1456:Myo15 UTSW 11 60508202 missense probably damaging 1.00
R1468:Myo15 UTSW 11 60506006 missense probably damaging 1.00
R1468:Myo15 UTSW 11 60506006 missense probably damaging 1.00
R1548:Myo15 UTSW 11 60488238 missense probably damaging 1.00
R1551:Myo15 UTSW 11 60492965 missense possibly damaging 0.70
R1571:Myo15 UTSW 11 60518464 missense probably damaging 1.00
R1662:Myo15 UTSW 11 60501701 missense probably damaging 1.00
R1777:Myo15 UTSW 11 60514936 missense probably benign
R1778:Myo15 UTSW 11 60478412 missense possibly damaging 0.57
R1847:Myo15 UTSW 11 60499495 nonsense probably null
R1875:Myo15 UTSW 11 60507528 missense probably damaging 0.99
R1944:Myo15 UTSW 11 60502083 missense probably damaging 0.99
R1945:Myo15 UTSW 11 60502083 missense probably damaging 0.99
R2013:Myo15 UTSW 11 60494231 missense probably damaging 1.00
R2107:Myo15 UTSW 11 60491810 missense probably damaging 1.00
R2108:Myo15 UTSW 11 60491810 missense probably damaging 1.00
R2112:Myo15 UTSW 11 60494168 missense probably damaging 0.99
R2147:Myo15 UTSW 11 60510229 missense possibly damaging 0.66
R2196:Myo15 UTSW 11 60510021 nonsense probably null
R2207:Myo15 UTSW 11 60506034 missense probably benign 0.01
R2245:Myo15 UTSW 11 60509099 missense probably damaging 1.00
R2367:Myo15 UTSW 11 60517238 missense probably damaging 0.99
R2374:Myo15 UTSW 11 60478843 missense possibly damaging 0.88
R2438:Myo15 UTSW 11 60483052 missense probably damaging 1.00
R3154:Myo15 UTSW 11 60479360 unclassified probably null
R3423:Myo15 UTSW 11 60510300 critical splice donor site probably null
R3551:Myo15 UTSW 11 60509663 missense possibly damaging 0.93
R3552:Myo15 UTSW 11 60509663 missense possibly damaging 0.93
R3612:Myo15 UTSW 11 60477679 missense probably damaging 1.00
R3620:Myo15 UTSW 11 60478642 missense possibly damaging 0.63
R3713:Myo15 UTSW 11 60479231 missense possibly damaging 0.55
R3714:Myo15 UTSW 11 60479231 missense possibly damaging 0.55
R3715:Myo15 UTSW 11 60479231 missense possibly damaging 0.55
R3783:Myo15 UTSW 11 60477572 missense probably damaging 0.97
R3784:Myo15 UTSW 11 60477572 missense probably damaging 0.97
R3785:Myo15 UTSW 11 60477572 missense probably damaging 0.97
R3786:Myo15 UTSW 11 60477572 missense probably damaging 0.97
R3787:Myo15 UTSW 11 60477572 missense probably damaging 0.97
R3894:Myo15 UTSW 11 60504319 missense probably benign 0.00
R3962:Myo15 UTSW 11 60479828 missense probably benign 0.00
R4082:Myo15 UTSW 11 60487196 missense possibly damaging 0.92
R4555:Myo15 UTSW 11 60496937 missense probably damaging 1.00
R4641:Myo15 UTSW 11 60503041 missense probably damaging 1.00
R4665:Myo15 UTSW 11 60504879 critical splice acceptor site probably null
R4713:Myo15 UTSW 11 60479930 missense probably benign 0.21
R4820:Myo15 UTSW 11 60476915 missense probably damaging 0.98
R5013:Myo15 UTSW 11 60491667 missense probably damaging 1.00
R5051:Myo15 UTSW 11 60487425 critical splice donor site probably null
R5187:Myo15 UTSW 11 60503614 missense probably damaging 1.00
R5230:Myo15 UTSW 11 60502848 missense possibly damaging 0.68
R5277:Myo15 UTSW 11 60477114 nonsense probably null
R5345:Myo15 UTSW 11 60497538 missense probably damaging 0.99
R5349:Myo15 UTSW 11 60493583 missense probably damaging 1.00
R5356:Myo15 UTSW 11 60498366 missense probably damaging 1.00
R5445:Myo15 UTSW 11 60520777 nonsense probably null
R5477:Myo15 UTSW 11 60477677 missense probably damaging 1.00
R5629:Myo15 UTSW 11 60479752 missense probably benign
R5728:Myo15 UTSW 11 60488896 missense probably damaging 1.00
R5818:Myo15 UTSW 11 60497951 missense probably benign 0.06
R5952:Myo15 UTSW 11 60479420 missense possibly damaging 0.50
R6338:Myo15 UTSW 11 60478133 missense probably damaging 0.99
R6467:Myo15 UTSW 11 60526661 critical splice donor site probably null
R6488:Myo15 UTSW 11 60478487 missense possibly damaging 0.86
R6521:Myo15 UTSW 11 60502369 missense probably damaging 1.00
R6645:Myo15 UTSW 11 60477292 missense probably benign 0.00
R6702:Myo15 UTSW 11 60492992 missense probably benign 0.16
R6703:Myo15 UTSW 11 60492992 missense probably benign 0.16
R6821:Myo15 UTSW 11 60524475 missense probably damaging 1.00
R6882:Myo15 UTSW 11 60524006 missense probably damaging 1.00
R6908:Myo15 UTSW 11 60506006 missense probably damaging 1.00
R6932:Myo15 UTSW 11 60499494 missense probably damaging 1.00
R6958:Myo15 UTSW 11 60503625 missense probably benign 0.07
X0021:Myo15 UTSW 11 60482359 nonsense probably null
X0066:Myo15 UTSW 11 60478220 missense probably damaging 1.00
X0067:Myo15 UTSW 11 60478618 missense possibly damaging 0.88
Mode of Inheritance Autosomal Recessive
Local Stock Live Mice
MMRRC Submission 037104-MU
Last Updated 2017-03-02 9:36 AM by Katherine Timer
Record Created 2013-07-01 9:29 AM by Jennifer Weatherly
Record Posted 2014-09-15
Phenotypic Description
Figure 1. The parker phenotype.

The parker phenotype was initially identified among G3 mice of the pedigree R0477, some of which displayed constant movement of the head from side-to-side, head tilt, circling behavior, and wobbling (Figure 1).

Nature of Mutation
Figure 2. Linkage mapping of the vestibular phenotype observed in parker using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 55 mutations (X-axis) identified in the G1 male of pedigree R0477.  Binary phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity.  Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 56 mutations. The vesitbular phenotype was linked to a mutation in Myo15: a T to C transition at 60,520,914 on chromosome 11, corresponding to base pair 51,576 in GenBank genomic region NC_000077.  Linkage was found with a recessive model of inheritance (P = 4.307 x 10-5), wherein 6 variant homozygotes departed phenotypically from 46 unaffected mice that were either homozygous variant (n = 9), heterozygous (n = 19), or homozygous for the reference allele (n = 18) (Figure 2). Myo15 encodes several isoforms including a long isoform (NM_182698; isoform 1; contains 66 total exons) and two others that lack in-frame exons in the 5’ coding region (isoform 2a (NM_182698; contains 64 total exons) and isoform 3 (NM_001103171; contains 65 total exons); see “Protein Prediction" for more details. The mutation is located in the donor splice site of intron 61 in isoform 1, intron 59 in isoform 2a, and intron 60 in isoform 3, two nucleotides from the previous exon in each transcript. The effect of the mutation at the cDNA and protein level of each isoform is unknown. One possibility, shown below, is that aberrant splicing may result in the skipping of the 161 base pair preceding exon (exon 61 in isoform 1 (shown); alternatively, exon 59 in isoform 2a and exon 60 in isoform 3) and splicing from exon 60 to exon 62 in isoform 1 (alternatively, splicing from exon 58 to exon 60 in isoform 2a or splicing from exon 59 to exon 61 in isoform 3). The aberrant splicing would lead to a deletion of 53 amino acids (amino acids 3244-3297) as well as a frameshift and subsequent coding of a premature stop codon.

       

           <--exon 60         <--exon 61-->           intron 61--> exon 62-->

49134 ……GTCACCAACCGAG GCCAGCACGTGTGT……ATGCACTACAATCAG gtcagagatg………GTTCTGCCTGA

3240  ……-V--T--N--R-- G--Q--H--V--C-……-M--H--Y--N--Q-              G--S--A--*   

                correct               deleted                            aberrant

 

Genomic numbering corresponds to NC_000077. Isoform 1 is shown. The donor splice site of intron 61 of Myo15, which is destroyed by the mutation, is indicated in blue; the mutated nucleotide is indicated in red.

Protein Prediction

Myosins are divided into conventional (muscle myosins and myosins similar in structure and function to muscle myosins, all belonging to class II) and unconventional classes (myosins that do not resemble muscle myosins). Myo15 encodes myosin XV (alternatively, Myosin XVa), a 3,511 amino acid member of the unconventional myosin family. 

 

Figure 3. Domain structure of myosin XV. At its N-terminus, myosin XV has an N-terminal extension (NTE); isoform 3 does not have the NTE. Within the motor domain, myosin XV has an ATP- and actin-binding site. Two IQ motifs are located within the neck of myosin XV. The C-terminal tail contains two myosin tail homology 4 (MyTH4) domains, a Src homology 3 (SH3) domain, and a 4.1/ezrin/radixin/moesin (FERM) domain. A FERM-like domain is predicted based on sequence similarity to one in human myosin VIIa, however, the precise location in mouse myosin XV has not been documented. At the C-terminus, myosin XV has a PDZ-ligand motif (ITLL*). The parker mutation (red asterisk) is located in the donor splice site of intron 61. See the text for more details.

Myosin XV has a proline-rich N-terminal extension [Figure 3; amino acids 1-1200; SMART(2;3)]. The N-terminal extension is encoded by exon 2 does not have sequence similarity to reported proteins and the function is unknown (2;4). Mouse Myo15 encodes transcript variants: isoform 1 encodes the full-length class 1 myosin XV protein, isoform 2a encodes a myosin XV protein without exon 2 and exon 26, and isoform 3 encodes a myosin XV protein without exon 2; all three isoforms are functional. Analysis of inner ear human MYO15 cDNAs determined that there are also several alternatively spliced MYO15 transcripts in human (3). The MYO15 cDNAs were individually missing exons 2, 8, 26, 30, 40, and 61 (3). Skipping of exons 30, 40, or 61 resulted in a frameshift that terminated the open reading frame shortly downstream of the missing exon (3). Skipping of exons 2, 8, or 26 did not interrupt the MYO15 reading frame (3). Exon 2 encodes the myosin XV start codon and encodes most of the 1223 amino acid N-terminal extension (3). The first start codon in-frame in the transcripts without exon 2 is located at the beginning of exon 3, coding 20 amino acids preceding the motor domain (3). Exon 8 encodes two amino acids in the motor domain, while exon 26 encodes an 18-amino acid insertion in the second IQ motif; a stop codon is introduced into the open reading frame in the long form of exon 26, resulting in truncation of the myosin XV protein after the IQ motifs (3).

 

Myosin XV has a highly conserved motor domain (amino acids 1200-1884; NM_010862; SMART) following the N-terminal extension (3). The motor domain contains an adenosine triphosphate (ATP)- and an actin-binding site (amino acids 1299-1306 and 1776-1783, respectively; Uniprot) (5-7). The motor domain in Nina C, a myosin expressed in the photoreceptor cells of Drosophila retinas, was necessary to maintain the structure of the photoreceptor cells (2). Missense mutations within the motor domain of myosin XV (e.g., C1779Y or R1354A;G1575A; NM_010862) resulted in mislocalization of myosin XV in the bodies of transfected wild-type auditory hair cells; the mutants were unable to properly target to the tips of the stereocilia (8).

 

The myosin neck region contains a variable number of light-chain binding (IQ) motifs (IQxxxRGxxxRK) and is linked to the motor domain by a converter region [(9); reviewed in (10;11)]. Myosin XV has two IQ motifs (1909-1920; LQRCLRGFFIKR and 1932-1943; LQSRARGYLARQ)  (2;3;6). The IQ motif is an α-helical structure that often mediates the binding of myosins to calmodulin, members of the EF-hand family of calcium-binding proteins, or myosin light chains [reviewed in (10;11)].

 

The tail regions of the myosins are divergent in length and sequence (6). The myosin XV tail is 1584 amino acids in length and has two myosin tail homology 4 (MyTH4) domains (amino acids 2049-2195 and 3031-3185; SMART), a band 4.1/ezrin/radixin/moesin (FERM)-like domain (amino acids 2687-2867, human myosin XVa), a Src homology 3 (SH3) domain (amino acids 2851-2933), and a FERM domain (alternatively, talin-like domain; amino acids 3188-3400) (2;3;12;13). MyTH4 domains have an unknown function, but are found in the tails of other myosins, including myosins IV, VIIA, X, and XII as well as kinesin-like motor proteins (3;12). The MyTH4 domain is proposed to function in microtubule binding as well as in actin binding to the plasma membrane (14). FERM domains are often found in membrane-associated proteins and mediate the interaction of the FERM-containing proteins with the cytoplasmic domains of integral membrane proteins and/or they function as a mediator between the cell membrane and actin cytoskeleton (12;15;16). The FERM domain of myosin XV is proposed to be involved in anchoring myosin XV to the cell membrane (2). SH3 domains function in recognizing and binding proline-rich sequences (17). SH3 domains are often found in proteins that function in synaptic vesicle endocytosis (18) and in the proper localization of proteins (19). The function of the myosin XV SH3 domain is unknown, but it is proposed to mediate an intramolecular interaction with a region in the proline-rich N-terminal extension to regulate the activity of myosin XV (3).

 

Myosin XV is unique among the myosins in that it has a predicted class I PDZ-ligand motif (ITLL*) at the C-terminus (8;13;20). The PDZ-ligand motif of myosin XV is required for association of myosin XV with whirlin as well as the localization of whirlin to stereocilia tips (described in “Background”, below) (8;21).

 

The parker mutation is predicted to result in a loss of exon 61 (isoform 1) encoding amino acids 3244-3297. In each of the isoforms, the parker mutation is predicted to result in the loss of a portion of the C-terminal FERM domain and the subsequent coding of a premature stop codon within that domain.  

Expression/Localization

Myo15 is expressed as early as embryonic day (E) 13.5 in the developing mouse inner ear (2).  At E15.5, Myo15 transcripts are expressed in the cristae ampularis, macula utriculi, and macula sacculi, and cochlea in the ear (2;3). At E18.5, Myo15 is restricted to the sensory epithelium of the organ of Corti in the cochlea (2;21). At postnatal day (P) 8, Myo15 is expressed in the inner hair cells and outer hair cells of the organ of Corti within the inner ear (2). In the adult mouse, Myo15 is also expressed in the brain and liver (5).

 

At P7 onward, myosin XV is localized to the capping region (i.e., the location of the growth and remodeling of the actin core) of the stereocilium in the inner ear hair cells, between the upper end of the actin core and apical plasma membrane (22-24). The amount of myosin XV is directly proportional to the length of the stereocilia (13;23;24). Myosin XV continuously migrates towards the plus ends of actin filaments and accumulates at the stereocilia tips (8;21).

 

Expression analysis of MYO15A in human tissues has been conflicting. Wang et al. determined that MYO15A is expressed in the cochlea of 18- to 22-week fetuses as well as in human fetal and adult brain, ovary, testis, kidney, and pituitary gland (6). Liang et al. determined that MYO15 was predominantly expressed in the adult pituitary gland, with less expression in the testis and ovary; low expression (compared to the expression level in the pituitary gland) was detected in the adult human brain, kidney, liver, lung, pancreas, placenta, or skeletal muscle (3). The discrepancies between the expression analysis in the Liang et al. study compared to that of Wang et al. was attributed to the design of the probe used in the Northern blot analysis (3). Additional studies determined that myosin XV mRNA and protein are expressed in all types of normal anterior pituitary cells and pituitary tumors, several cells of all endocrine tumors of the gut and pancreas, normal endocrine cells of the small bowel, gastric, adrenal medulla, paraganglionic tissue as well as in most pancreatic islet cells (25;26).  Expression was variable in pituitary cells; the most intense staining was observed in the secretory granules of adrenocorticotropic hormone, prolactin, and glycoprotein hormone-producing cells (26)

Background
Figure 4. Sensory cells in the inner ear and retina. (A) Inner hair cells are located within the organ of Corti. The hair bundle is composed of numerous stereocilia that develop from microvilli and have a stiff core of parallel actin filaments anchored in the cuticular plate, a meshwork of horizontal actin filaments beneath the apical cell membrane. Lateral to the tallest stereocilium is the kinocilium, which is formed from the basal body. The stereocilia are connected to each other by numerous filaments, including tip links, horizontal top connectors, transient lateral links and ankle links. The synaptic junction between the hair cell and afferent and efferent neurons is located at the base of the cell and contains ribbons. (B) The molecular components of the cross link complexes of the inner ear hair cell. In the tip link, cadherin23 interacts with protocadherin15, harmonin, Myo7a, Myo1c, calmodulin, and Sans to help maintain the structure and function of the inner ear hair cell. (C) Rod and cone cells are highly polarized photoreceptors. The outer segment is a modified cilium and is attached to the inner segment by a connecting cilium. The nucleus is located within the outer nuclear layer. The synaptic terminals contain ribbons and connect the photoreceptor cells with horizontal, ganglion, and bipolar (shown) cells.

Myosins are actin-based molecular motors that generate mechanical force using the energy generated from the hydrolysis of adenosine triphosphate (ATP) (3;6). Myosins function in organelle and vesicle movement, cytokinesis, phagocytosis, signal transduction, cellular movement, membrane trafficking, regulation of ion channels, and muscle contraction (5;27;28). For more information about the general functions of myosins see mayday circler (Myo6) and new gray (Myo5a).

 

Each hair cell in the inner ear is comprised of a bundle of up to 300 stereocilia that project from the apical cell surface (13;29); each stereocilium is filled with up to 1000 polarized and cross-linked actin filaments [Figure 4(22)]. The stereocilia are organized in a staircase pattern and held together by extracellular lateral projections (side-links). Deflection of the hair bundle results in gating of transducer channels at the tips of the stereocilia and subsequent modulation of the cell membrane potential that converts the sound-evoked mechanical stimulus into an electrical signal (i.e., mechano-electrical transduction) (29;30). For more information about proteins involved in the maintenance and function of the hair cells of the inner ear please see the records for dee dee and squirm. Myosin XI (see mayday circler) also functions in the development and/or maintenance of sensory hair cells; the function of myosin XV and myosin XI do not overlap (9). Myosin XV functions in the assembly and maintenance of actin organization in hair cells of the inner ear by acting as a motor and carrier along the length of the actin filament within the hair cells (31). Myosin XV senses the tension between the plasma membrane and the actin filaments, a function that is necessary in the growth of the steocilia (13). Myosin XV contributes to the elongation of stereocilia by delivering whirlin, a multi-PDZ domain-containing scaffold protein, to the stereocilia tips (8). Both myosin XV and whirlin are required for the elongation and staircase formation of the stereocilia bundle and myosin XV and whirlin may function as part of a complex that modulates the growth of actin bundles in the stereocilia (8;13). Another proposed function of myosin XV is the maintenance of the hair cell mechanotransduction apparatus at the tips of the stereocilia (5;8).  The function of myosin XV in endocrine cells is unknown. Within pituitary cells and pituitary adenomas, myosin XV may function in cytoplasmic organelle movement, including secretory granules and/or hormone secretion (25).

 

Two myosin XV mutant mouse models, shaker 2 (Myo15sh2; MGI:1857036) and shaker 2J (Myo15sh2J; MGI:1889795) have been characterized. The Myo15sh2 mutation is a tyrosine to cysteine substitution at amino acid 1779 within the myosin motor domain (5;7). The spontaneous Myo15sh2J mutation results in the deletion of the last six exons and part of the 3’ flanking region encoding the myosin XV C-terminus, including the C-terminal FERM domain (2). Both the shaker 2 and shaker 2J mice have abnormally short stereocilia bundles on the inner ear hair cells compared to wild-type mice; the bundles are correctly positioned (2;5). As a result, the shaker 2 and shaker 2J homozygous mice are congenitally deaf and exhibit vestibular defects that cause head-tossing and circling behavior (3-5). The mechanosensory activity of the short stereocilia in young shaker 2 mice are not affected despite the changes in stereocilia length (32). Further studies determined that the Myo15sh2 mutation disrupts fast adaptation and calcium sensitivity in cochlear inner hair cells (33). In the inner hair cells of young (up to P14) shaker 2 mice, the mechanosensitivity is mediated by “top-to-top” links that run perpendicular to the shortened stereocilia; the outer hair cells have a prominent staircase stereocilia arrangement and obliquely-oriented tip links (32;33). Lack of myosin XV expression allows myosin VIIa molecules to localize between the plasma membrane and actin bundle in the short stereocilia of the shaker 2 mice; no myosin XV was detected at the tips of inner ear hair cell stereocilia (22). Transfection of a green fluorescent protein (GFP)-Myo15 into shaker 2 sensory epithelial explants resulted in complete rescue of the normal length and shape of the hair bundles by 67 hours post-transfection (8). In addition, a bacterial artificial chromosome (BAC)-mediated transgene corrected the deafness and circling phenotype of shaker 2 mice and the hair cells had normal stereocilia and no unusual actin-containing structures (5). A spontaneous mutant rat model, LEW/Ztm-ci2, exhibits syndromal deafness as well as spontaneous lateralized circling behavior, locomotor hyperactivity, moderate ataxia and the inability to swim (31). The ci2 model has a leucine to proline substitution at amino acid 3157 in the myosin XV protein within the C-terminal MyTH4 domain (31). In this model, the organ of Corti was completely absent or reduced (31). The inner hair cells of the vestibular organs were present, but there was shortened stereocilia, a lower number of ganglion cells, and a reduced thickness of axons (31)

 

As of 2009, 24 mutations in MYO15A have been linked to autosomal recessive nonsyndromic congenital deafness [(DFNB3; OMIM: #600316); (4;6;21)]; nonsyndromic recessive deafness accounts for ~80% of hereditary hearing loss (6)

Putative Mechanism

The Myo15parker mutation is predicted to be similar to the Myo15sh2J mutation; both mutations affect the C-terminal FERM domain and result in the deletion of the last six exons of Myo15 (2). Similar to the shaker 2J mice, the parker mice exhibit head-tossing and circling behavior. Anderson et al. propose that the myosin XVshaker 2J protein is unable to exert force on the actin cytoskeleton because the truncated protein is improperly anchored, resulting in a failure to form the scaffolding to form the normal stereocilia structure (2).  

Primers PCR Primer
parker(F):5'- GCATGTGGCTTAGACCACAGTGTTC -3'
parker(R):5'- GCACACTATCAGGCTATGCAGAGG -3'

Sequencing Primer
parker_seq(F):5'- AGACCACAGTGTTCCTTCTTC -3'
parker_seq(R):5'- agctggcctggagcttg -3'
Genotyping

Parker genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide transition.
 

PCR Primers

Parker(F): 5’- GCATGTGGCTTAGACCACAGTGTTC-3’

Parker(R): 5’- GCACACTATCAGGCTATGCAGAGG-3’

 

Sequencing Primer

Parker_seq(F): 5’- AGACCACAGTGTTCCTTCTTC-3’
 

 

PCR program

1) 94°C             2:00

2) 94°C             0:30

3) 55°C             0:30

4) 72°C             1:00

5) repeat steps (2-4) 40X

6) 72°C             10:00

7) 4°C               ∞

 

The following sequence of 533 nucleotides from GenBank genomic region NC_000077 encoding Myo15) is amplified:

 

51357                                                              gcat

51361 gtggcttaga ccacagtgtt ccttcttcca gccgtgcctc tttctccctg caggccagca

51421 cgtgtgtcca ctgagctgcc gggcctacat actggatgtg gcctcagaga tggagcaggt

51481 ggacgggggc tacacactct ggttccggcg ggtgctttgg gatcagccac tgaagtttga

51541 gaatgagctg tatgtgacca tgcactacaa tcaggtcaga gatgcgacct ccctattgct

51601 ctgaacctac agtgccacgc ccagatgctt ggggaacttg taccaaagct ttagcaattc

51661 cacttacaaa acacaaccac gttgttggat gtggtaatgt atgccttgaa ttctagtgct

51721 caggaggcag aagcaggcag atctctgtga gttagaggcc agcctggtct acatagcaag

51781 ctccaggcca gctaaggcta tatagaaaga tcttttctga aacacacagc aacttcattc

51841 tgggaccaca tggtgttgag acctacctct gcatagcctg atagtgtgc

 

Primer binding sites are underlined and the sequencing primer is highlighted; the mutated nucleotide is shown in red text.

References
Science Writers Anne Murray
Illustrators Peter Jurek
AuthorsJennifer Weatherly Tiana Purrington Bruce Beutler
List |< first << previous [record 52 of 74] next >> last >|