Incidental Mutation 'R0899:Myo15'
ID 83805
Institutional Source Beutler Lab
Gene Symbol Myo15
Ensembl Gene ENSMUSG00000042678
Gene Name myosin XV
Synonyms sh2; sh-2; Myo15a
MMRRC Submission 039059-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0899 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 60469339-60528369 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 60477185 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 257 (Y257C)
Ref Sequence ENSEMBL: ENSMUSP00000091686 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071880] [ENSMUST00000081823] [ENSMUST00000094135]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000071880
AA Change: Y257C

PolyPhen 2 Score 0.865 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000071777
Gene: ENSMUSG00000042678
AA Change: Y257C

DomainStartEndE-ValueType
low complexity region 4 24 N/A INTRINSIC
low complexity region 87 100 N/A INTRINSIC
low complexity region 107 120 N/A INTRINSIC
low complexity region 269 292 N/A INTRINSIC
low complexity region 295 306 N/A INTRINSIC
low complexity region 311 325 N/A INTRINSIC
low complexity region 349 384 N/A INTRINSIC
low complexity region 425 435 N/A INTRINSIC
low complexity region 487 498 N/A INTRINSIC
low complexity region 502 509 N/A INTRINSIC
low complexity region 653 681 N/A INTRINSIC
low complexity region 692 705 N/A INTRINSIC
low complexity region 737 747 N/A INTRINSIC
low complexity region 758 775 N/A INTRINSIC
low complexity region 781 792 N/A INTRINSIC
low complexity region 796 809 N/A INTRINSIC
low complexity region 825 849 N/A INTRINSIC
low complexity region 883 897 N/A INTRINSIC
low complexity region 1067 1082 N/A INTRINSIC
low complexity region 1115 1130 N/A INTRINSIC
MYSc 1200 1884 N/A SMART
IQ 1885 1907 1.63e-1 SMART
IQ 1908 1930 1.77e-2 SMART
IQ 1931 1953 2.97e2 SMART
low complexity region 1955 1974 N/A INTRINSIC
low complexity region 1992 2006 N/A INTRINSIC
MyTH4 2049 2195 1.8e-42 SMART
low complexity region 2396 2405 N/A INTRINSIC
low complexity region 2451 2461 N/A INTRINSIC
Blast:MYSc 2665 2848 2e-14 BLAST
SH3 2851 2933 1.55e-4 SMART
low complexity region 2949 2962 N/A INTRINSIC
MyTH4 3031 3185 5.59e-48 SMART
B41 3188 3400 6.94e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000081823
SMART Domains Protein: ENSMUSP00000080507
Gene: ENSMUSG00000042678

DomainStartEndE-ValueType
MYSc 13 697 N/A SMART
IQ 698 720 1.63e-1 SMART
IQ 721 743 1.77e-2 SMART
IQ 744 766 2.97e2 SMART
low complexity region 787 801 N/A INTRINSIC
MyTH4 844 990 1.8e-42 SMART
low complexity region 1191 1200 N/A INTRINSIC
low complexity region 1246 1256 N/A INTRINSIC
Blast:MYSc 1460 1643 7e-15 BLAST
SH3 1646 1728 1.55e-4 SMART
low complexity region 1744 1757 N/A INTRINSIC
MyTH4 1826 1980 5.59e-48 SMART
B41 1983 2195 6.94e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000094135
AA Change: Y257C

PolyPhen 2 Score 0.865 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000091686
Gene: ENSMUSG00000042678
AA Change: Y257C

DomainStartEndE-ValueType
low complexity region 4 24 N/A INTRINSIC
low complexity region 87 100 N/A INTRINSIC
low complexity region 107 120 N/A INTRINSIC
low complexity region 269 292 N/A INTRINSIC
low complexity region 295 306 N/A INTRINSIC
low complexity region 311 325 N/A INTRINSIC
low complexity region 349 384 N/A INTRINSIC
low complexity region 425 435 N/A INTRINSIC
low complexity region 487 498 N/A INTRINSIC
low complexity region 502 509 N/A INTRINSIC
low complexity region 653 681 N/A INTRINSIC
low complexity region 692 705 N/A INTRINSIC
low complexity region 737 747 N/A INTRINSIC
low complexity region 758 775 N/A INTRINSIC
low complexity region 781 792 N/A INTRINSIC
low complexity region 796 809 N/A INTRINSIC
low complexity region 825 849 N/A INTRINSIC
low complexity region 883 897 N/A INTRINSIC
low complexity region 1067 1082 N/A INTRINSIC
low complexity region 1115 1130 N/A INTRINSIC
MYSc 1200 1884 N/A SMART
IQ 1885 1907 1.63e-1 SMART
IQ 1908 1930 1.77e-2 SMART
IQ 1931 1953 2.97e2 SMART
low complexity region 1974 1988 N/A INTRINSIC
MyTH4 2031 2177 1.8e-42 SMART
low complexity region 2378 2387 N/A INTRINSIC
low complexity region 2433 2443 N/A INTRINSIC
Blast:MYSc 2647 2830 2e-14 BLAST
SH3 2833 2915 1.55e-4 SMART
low complexity region 2931 2944 N/A INTRINSIC
MyTH4 3013 3167 5.59e-48 SMART
B41 3170 3382 6.94e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000126522
SMART Domains Protein: ENSMUSP00000120839
Gene: ENSMUSG00000042678

DomainStartEndE-ValueType
MYSc 34 716 N/A SMART
IQ 717 739 1.63e-1 SMART
IQ 740 762 1.77e-2 SMART
IQ 763 785 2.97e2 SMART
low complexity region 806 820 N/A INTRINSIC
MyTH4 863 1009 1.8e-42 SMART
low complexity region 1210 1219 N/A INTRINSIC
low complexity region 1265 1275 N/A INTRINSIC
Blast:MYSc 1479 1662 5e-15 BLAST
SH3 1665 1747 1.55e-4 SMART
low complexity region 1763 1776 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.0%
  • 10x: 97.2%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an unconventional myosin. This protein differs from other myosins in that it has a long N-terminal extension preceding the conserved motor domain. Studies in mice suggest that this protein is necessary for actin organization in the hair cells of the cochlea. Mutations in this gene have been associated with profound, congenital, neurosensory, nonsyndromal deafness. This gene is located within the Smith-Magenis syndrome region on chromosome 17. Read-through transcripts containing an upstream gene and this gene have been identified, but they are not thought to encode a fusion protein. Several alternatively spliced transcript variants have been described, but their full length sequences have not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations in this gene result in profound deafness and neurological behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5031439G07Rik T C 15: 84,949,258 (GRCm38) K442E probably damaging Het
Adamts1 G A 16: 85,798,052 (GRCm38) R340* probably null Het
Afg3l2 T C 18: 67,422,977 (GRCm38) N428S possibly damaging Het
Aqp12 G A 1: 93,006,610 (GRCm38) D70N probably damaging Het
Astn1 T A 1: 158,511,109 (GRCm38) C475* probably null Het
Atp2b1 G A 10: 99,017,031 (GRCm38) probably null Het
Cbln2 T C 18: 86,716,752 (GRCm38) S217P possibly damaging Het
Ces2h T C 8: 105,014,550 (GRCm38) L58P probably damaging Het
Cfap43 C T 19: 47,747,994 (GRCm38) G1353R possibly damaging Het
Crcp A G 5: 130,059,831 (GRCm38) M91V probably benign Het
Cubn A G 2: 13,362,328 (GRCm38) V1577A possibly damaging Het
Dthd1 A G 5: 62,842,928 (GRCm38) H531R probably benign Het
Fam120a G T 13: 48,885,743 (GRCm38) A979E possibly damaging Het
Fat2 C T 11: 55,256,225 (GRCm38) G3982S probably damaging Het
Fbxo44 C G 4: 148,156,269 (GRCm38) R220S probably damaging Het
Fcnb T A 2: 28,076,779 (GRCm38) K247N probably damaging Het
Gm4763 C T 7: 24,723,312 (GRCm38) R112H probably benign Het
Gtf2a1l A G 17: 88,668,724 (GRCm38) N5S Het
Htr3a T A 9: 48,901,452 (GRCm38) D229V possibly damaging Het
Ipo11 A C 13: 106,900,816 (GRCm38) L173* probably null Het
Jam3 C A 9: 27,098,957 (GRCm38) G244W probably damaging Het
Mrpl52 C T 14: 54,427,084 (GRCm38) R12* probably null Het
Myocd G A 11: 65,195,192 (GRCm38) P215L possibly damaging Het
Ndst1 T C 18: 60,707,882 (GRCm38) T243A probably benign Het
Obox5 A T 7: 15,758,875 (GRCm38) T252S probably benign Het
Oit1 A G 14: 8,364,863 (GRCm38) I16T probably damaging Het
Olfr1026 A G 2: 85,923,387 (GRCm38) T40A probably benign Het
Olfr790 T C 10: 129,501,432 (GRCm38) F183L probably damaging Het
Olfr854 A C 9: 19,566,547 (GRCm38) V276G probably damaging Het
Osbpl1a T C 18: 12,757,690 (GRCm38) S377G possibly damaging Het
Pfkl A G 10: 78,005,439 (GRCm38) probably null Het
Prdm16 A T 4: 154,528,909 (GRCm38) N20K probably damaging Het
Prkd1 A G 12: 50,385,193 (GRCm38) I589T probably damaging Het
Scnn1b G A 7: 121,917,715 (GRCm38) G525S probably damaging Het
Tktl2 G A 8: 66,512,347 (GRCm38) V186M probably damaging Het
Ttn A G 2: 76,887,985 (GRCm38) probably benign Het
Wap T C 11: 6,636,725 (GRCm38) T125A probably benign Het
Wdr86 C T 5: 24,718,007 (GRCm38) R229Q probably benign Het
Other mutations in Myo15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00845:Myo15 APN 11 60,477,779 (GRCm38) missense probably damaging 1.00
IGL01011:Myo15 APN 11 60,476,992 (GRCm38) missense probably benign 0.33
IGL01100:Myo15 APN 11 60,511,158 (GRCm38) missense probably damaging 1.00
IGL01357:Myo15 APN 11 60,502,289 (GRCm38) splice site probably benign
IGL01634:Myo15 APN 11 60,495,472 (GRCm38) missense probably damaging 1.00
IGL01763:Myo15 APN 11 60,521,738 (GRCm38) missense probably benign 0.07
IGL01901:Myo15 APN 11 60,527,434 (GRCm38) utr 3 prime probably benign
IGL01931:Myo15 APN 11 60,496,138 (GRCm38) missense probably damaging 1.00
IGL02006:Myo15 APN 11 60,511,128 (GRCm38) missense probably damaging 1.00
IGL02041:Myo15 APN 11 60,506,863 (GRCm38) missense probably damaging 0.99
IGL02094:Myo15 APN 11 60,510,647 (GRCm38) unclassified probably benign
IGL02122:Myo15 APN 11 60,483,466 (GRCm38) missense probably benign 0.23
IGL02153:Myo15 APN 11 60,498,397 (GRCm38) missense probably damaging 1.00
IGL02328:Myo15 APN 11 60,526,607 (GRCm38) missense probably benign 0.13
IGL02330:Myo15 APN 11 60,477,161 (GRCm38) missense possibly damaging 0.94
IGL02431:Myo15 APN 11 60,510,639 (GRCm38) missense possibly damaging 0.73
IGL02639:Myo15 APN 11 60,478,621 (GRCm38) missense probably benign
IGL02659:Myo15 APN 11 60,491,783 (GRCm38) splice site probably benign
IGL02800:Myo15 APN 11 60,502,369 (GRCm38) missense probably damaging 1.00
IGL02812:Myo15 APN 11 60,477,179 (GRCm38) missense probably benign 0.15
IGL02863:Myo15 APN 11 60,478,127 (GRCm38) missense probably damaging 1.00
IGL02873:Myo15 APN 11 60,483,482 (GRCm38) missense probably damaging 1.00
IGL02990:Myo15 APN 11 60,479,440 (GRCm38) missense probably benign 0.02
IGL03011:Myo15 APN 11 60,509,531 (GRCm38) splice site probably benign
IGL03243:Myo15 APN 11 60,496,518 (GRCm38) missense probably damaging 1.00
IGL03297:Myo15 APN 11 60,479,141 (GRCm38) missense probably damaging 1.00
novichok UTSW 11 60,481,740 (GRCm38) critical splice donor site probably null
parker UTSW 11 60,520,914 (GRCm38) critical splice donor site probably null
Typhoon UTSW 11 60,487,425 (GRCm38) critical splice donor site probably null
PIT4131001:Myo15 UTSW 11 60,495,454 (GRCm38) missense probably damaging 1.00
PIT4131001:Myo15 UTSW 11 60,483,127 (GRCm38) missense probably damaging 1.00
R0133:Myo15 UTSW 11 60,477,850 (GRCm38) missense possibly damaging 0.94
R0265:Myo15 UTSW 11 60,514,897 (GRCm38) critical splice acceptor site probably null
R0389:Myo15 UTSW 11 60,478,538 (GRCm38) missense probably benign
R0416:Myo15 UTSW 11 60,511,174 (GRCm38) missense probably damaging 1.00
R0449:Myo15 UTSW 11 60,509,596 (GRCm38) missense possibly damaging 0.92
R0477:Myo15 UTSW 11 60,520,914 (GRCm38) critical splice donor site probably null
R0543:Myo15 UTSW 11 60,479,051 (GRCm38) missense probably benign
R0546:Myo15 UTSW 11 60,506,313 (GRCm38) missense probably damaging 1.00
R0555:Myo15 UTSW 11 60,521,638 (GRCm38) missense probably damaging 1.00
R0639:Myo15 UTSW 11 60,479,336 (GRCm38) missense probably benign 0.12
R0723:Myo15 UTSW 11 60,478,977 (GRCm38) missense possibly damaging 0.94
R0837:Myo15 UTSW 11 60,487,251 (GRCm38) missense probably damaging 0.98
R0865:Myo15 UTSW 11 60,491,688 (GRCm38) missense probably damaging 1.00
R1022:Myo15 UTSW 11 60,479,616 (GRCm38) missense probably benign 0.00
R1024:Myo15 UTSW 11 60,479,616 (GRCm38) missense probably benign 0.00
R1035:Myo15 UTSW 11 60,510,558 (GRCm38) unclassified probably benign
R1109:Myo15 UTSW 11 60,493,066 (GRCm38) missense probably damaging 1.00
R1170:Myo15 UTSW 11 60,479,407 (GRCm38) missense probably benign 0.04
R1241:Myo15 UTSW 11 60,499,430 (GRCm38) missense possibly damaging 0.58
R1392:Myo15 UTSW 11 60,477,974 (GRCm38) missense possibly damaging 0.95
R1392:Myo15 UTSW 11 60,477,974 (GRCm38) missense possibly damaging 0.95
R1434:Myo15 UTSW 11 60,504,331 (GRCm38) missense probably benign 0.00
R1450:Myo15 UTSW 11 60,495,482 (GRCm38) missense probably damaging 1.00
R1456:Myo15 UTSW 11 60,508,202 (GRCm38) missense probably damaging 1.00
R1468:Myo15 UTSW 11 60,506,006 (GRCm38) missense probably damaging 1.00
R1468:Myo15 UTSW 11 60,506,006 (GRCm38) missense probably damaging 1.00
R1548:Myo15 UTSW 11 60,488,238 (GRCm38) missense probably damaging 1.00
R1551:Myo15 UTSW 11 60,492,965 (GRCm38) missense possibly damaging 0.70
R1571:Myo15 UTSW 11 60,518,464 (GRCm38) missense probably damaging 1.00
R1662:Myo15 UTSW 11 60,501,701 (GRCm38) missense probably damaging 1.00
R1777:Myo15 UTSW 11 60,514,936 (GRCm38) missense probably benign
R1778:Myo15 UTSW 11 60,478,412 (GRCm38) missense possibly damaging 0.57
R1847:Myo15 UTSW 11 60,499,495 (GRCm38) nonsense probably null
R1875:Myo15 UTSW 11 60,507,528 (GRCm38) missense probably damaging 0.99
R1944:Myo15 UTSW 11 60,502,083 (GRCm38) missense probably damaging 0.99
R1945:Myo15 UTSW 11 60,502,083 (GRCm38) missense probably damaging 0.99
R2013:Myo15 UTSW 11 60,494,231 (GRCm38) missense probably damaging 1.00
R2107:Myo15 UTSW 11 60,491,810 (GRCm38) missense probably damaging 1.00
R2108:Myo15 UTSW 11 60,491,810 (GRCm38) missense probably damaging 1.00
R2112:Myo15 UTSW 11 60,494,168 (GRCm38) missense probably damaging 0.99
R2147:Myo15 UTSW 11 60,510,229 (GRCm38) missense possibly damaging 0.66
R2196:Myo15 UTSW 11 60,510,021 (GRCm38) nonsense probably null
R2207:Myo15 UTSW 11 60,506,034 (GRCm38) missense probably benign 0.01
R2245:Myo15 UTSW 11 60,509,099 (GRCm38) missense probably damaging 1.00
R2367:Myo15 UTSW 11 60,517,238 (GRCm38) missense probably damaging 0.99
R2374:Myo15 UTSW 11 60,478,843 (GRCm38) missense possibly damaging 0.88
R2438:Myo15 UTSW 11 60,483,052 (GRCm38) missense probably damaging 1.00
R3154:Myo15 UTSW 11 60,479,360 (GRCm38) splice site probably null
R3423:Myo15 UTSW 11 60,510,300 (GRCm38) critical splice donor site probably null
R3551:Myo15 UTSW 11 60,509,663 (GRCm38) missense possibly damaging 0.93
R3552:Myo15 UTSW 11 60,509,663 (GRCm38) missense possibly damaging 0.93
R3612:Myo15 UTSW 11 60,477,679 (GRCm38) missense probably damaging 1.00
R3620:Myo15 UTSW 11 60,478,642 (GRCm38) missense possibly damaging 0.63
R3713:Myo15 UTSW 11 60,479,231 (GRCm38) missense possibly damaging 0.55
R3714:Myo15 UTSW 11 60,479,231 (GRCm38) missense possibly damaging 0.55
R3715:Myo15 UTSW 11 60,479,231 (GRCm38) missense possibly damaging 0.55
R3783:Myo15 UTSW 11 60,477,572 (GRCm38) missense probably damaging 0.97
R3784:Myo15 UTSW 11 60,477,572 (GRCm38) missense probably damaging 0.97
R3785:Myo15 UTSW 11 60,477,572 (GRCm38) missense probably damaging 0.97
R3786:Myo15 UTSW 11 60,477,572 (GRCm38) missense probably damaging 0.97
R3787:Myo15 UTSW 11 60,477,572 (GRCm38) missense probably damaging 0.97
R3894:Myo15 UTSW 11 60,504,319 (GRCm38) missense probably benign 0.00
R3962:Myo15 UTSW 11 60,479,828 (GRCm38) missense probably benign 0.00
R4082:Myo15 UTSW 11 60,487,196 (GRCm38) missense possibly damaging 0.92
R4555:Myo15 UTSW 11 60,496,937 (GRCm38) missense probably damaging 1.00
R4641:Myo15 UTSW 11 60,503,041 (GRCm38) missense probably damaging 1.00
R4665:Myo15 UTSW 11 60,504,879 (GRCm38) critical splice acceptor site probably null
R4713:Myo15 UTSW 11 60,479,930 (GRCm38) missense probably benign 0.21
R4820:Myo15 UTSW 11 60,476,915 (GRCm38) missense probably damaging 0.98
R5013:Myo15 UTSW 11 60,491,667 (GRCm38) missense probably damaging 1.00
R5051:Myo15 UTSW 11 60,487,425 (GRCm38) critical splice donor site probably null
R5187:Myo15 UTSW 11 60,503,614 (GRCm38) missense probably damaging 1.00
R5230:Myo15 UTSW 11 60,502,848 (GRCm38) missense possibly damaging 0.68
R5277:Myo15 UTSW 11 60,477,114 (GRCm38) nonsense probably null
R5345:Myo15 UTSW 11 60,497,538 (GRCm38) missense probably damaging 0.99
R5349:Myo15 UTSW 11 60,493,583 (GRCm38) missense probably damaging 1.00
R5356:Myo15 UTSW 11 60,498,366 (GRCm38) missense probably damaging 1.00
R5445:Myo15 UTSW 11 60,520,777 (GRCm38) nonsense probably null
R5477:Myo15 UTSW 11 60,477,677 (GRCm38) missense probably damaging 1.00
R5629:Myo15 UTSW 11 60,479,752 (GRCm38) missense probably benign
R5728:Myo15 UTSW 11 60,488,896 (GRCm38) missense probably damaging 1.00
R5818:Myo15 UTSW 11 60,497,951 (GRCm38) missense probably benign 0.06
R5952:Myo15 UTSW 11 60,479,420 (GRCm38) missense possibly damaging 0.50
R6338:Myo15 UTSW 11 60,478,133 (GRCm38) missense probably damaging 0.99
R6467:Myo15 UTSW 11 60,526,661 (GRCm38) critical splice donor site probably null
R6488:Myo15 UTSW 11 60,478,487 (GRCm38) missense possibly damaging 0.86
R6521:Myo15 UTSW 11 60,502,369 (GRCm38) missense probably damaging 1.00
R6645:Myo15 UTSW 11 60,477,292 (GRCm38) missense probably benign 0.00
R6702:Myo15 UTSW 11 60,492,992 (GRCm38) missense probably benign 0.16
R6703:Myo15 UTSW 11 60,492,992 (GRCm38) missense probably benign 0.16
R6821:Myo15 UTSW 11 60,524,475 (GRCm38) missense probably damaging 1.00
R6882:Myo15 UTSW 11 60,524,006 (GRCm38) missense probably damaging 1.00
R6908:Myo15 UTSW 11 60,506,006 (GRCm38) missense probably damaging 1.00
R6932:Myo15 UTSW 11 60,499,494 (GRCm38) missense probably damaging 1.00
R6958:Myo15 UTSW 11 60,503,625 (GRCm38) missense probably benign 0.07
R7041:Myo15 UTSW 11 60,506,006 (GRCm38) missense probably damaging 1.00
R7149:Myo15 UTSW 11 60,510,010 (GRCm38) missense possibly damaging 0.56
R7163:Myo15 UTSW 11 60,498,369 (GRCm38) missense
R7229:Myo15 UTSW 11 60,496,495 (GRCm38) missense probably benign 0.08
R7347:Myo15 UTSW 11 60,477,961 (GRCm38) missense probably benign
R7368:Myo15 UTSW 11 60,490,915 (GRCm38) splice site probably null
R7392:Myo15 UTSW 11 60,505,976 (GRCm38) missense
R7414:Myo15 UTSW 11 60,483,483 (GRCm38) missense
R7461:Myo15 UTSW 11 60,505,152 (GRCm38) missense
R7609:Myo15 UTSW 11 60,488,811 (GRCm38) missense
R7613:Myo15 UTSW 11 60,505,152 (GRCm38) missense
R7734:Myo15 UTSW 11 60,510,282 (GRCm38) missense probably benign
R7748:Myo15 UTSW 11 60,504,901 (GRCm38) missense
R7767:Myo15 UTSW 11 60,502,096 (GRCm38) missense
R7769:Myo15 UTSW 11 60,509,149 (GRCm38) missense
R7894:Myo15 UTSW 11 60,491,137 (GRCm38) missense
R7919:Myo15 UTSW 11 60,526,530 (GRCm38) missense probably damaging 1.00
R8100:Myo15 UTSW 11 60,517,190 (GRCm38) missense probably damaging 1.00
R8124:Myo15 UTSW 11 60,507,453 (GRCm38) missense
R8129:Myo15 UTSW 11 60,508,200 (GRCm38) missense
R8428:Myo15 UTSW 11 60,496,415 (GRCm38) missense probably damaging 1.00
R8706:Myo15 UTSW 11 60,479,617 (GRCm38) missense probably benign
R8735:Myo15 UTSW 11 60,510,853 (GRCm38) critical splice acceptor site probably null
R8739:Myo15 UTSW 11 60,477,262 (GRCm38) missense probably benign 0.06
R8790:Myo15 UTSW 11 60,487,221 (GRCm38) missense
R8790:Myo15 UTSW 11 60,476,536 (GRCm38) missense possibly damaging 0.73
R8822:Myo15 UTSW 11 60,476,914 (GRCm38) missense probably damaging 0.99
R8907:Myo15 UTSW 11 60,526,608 (GRCm38) missense
R8931:Myo15 UTSW 11 60,477,194 (GRCm38) missense probably benign
R9061:Myo15 UTSW 11 60,502,866 (GRCm38) missense
R9124:Myo15 UTSW 11 60,479,126 (GRCm38) missense probably benign 0.37
R9297:Myo15 UTSW 11 60,495,073 (GRCm38) missense probably null
R9347:Myo15 UTSW 11 60,483,729 (GRCm38) missense
R9417:Myo15 UTSW 11 60,487,417 (GRCm38) missense
R9456:Myo15 UTSW 11 60,501,842 (GRCm38) missense
R9460:Myo15 UTSW 11 60,481,740 (GRCm38) critical splice donor site probably null
R9615:Myo15 UTSW 11 60,483,494 (GRCm38) missense
R9630:Myo15 UTSW 11 60,517,162 (GRCm38) missense probably damaging 1.00
R9746:Myo15 UTSW 11 60,487,408 (GRCm38) nonsense probably null
X0021:Myo15 UTSW 11 60,482,359 (GRCm38) nonsense probably null
X0066:Myo15 UTSW 11 60,478,220 (GRCm38) missense probably damaging 1.00
X0067:Myo15 UTSW 11 60,478,618 (GRCm38) missense possibly damaging 0.88
Z1176:Myo15 UTSW 11 60,498,403 (GRCm38) missense
Z1176:Myo15 UTSW 11 60,488,258 (GRCm38) missense
Z1176:Myo15 UTSW 11 60,524,441 (GRCm38) missense probably damaging 1.00
Z1177:Myo15 UTSW 11 60,495,475 (GRCm38) missense
Z1177:Myo15 UTSW 11 60,488,837 (GRCm38) missense
Z1177:Myo15 UTSW 11 60,477,523 (GRCm38) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCTCAAGAAGGCCGAAGAGTCAG -3'
(R):5'- TCGTAGCCGTAGCCATAGCCATAG -3'

Sequencing Primer
(F):5'- TTGGCTCACGTAAGCTGC -3'
(R):5'- CGTAGCCATAGCCATAGGCATAG -3'
Posted On 2013-11-08