Incidental Mutation 'R4367:Cyp1a1'
ID325814
Institutional Source Beutler Lab
Gene Symbol Cyp1a1
Ensembl Gene ENSMUSG00000032315
Gene Namecytochrome P450, family 1, subfamily a, polypeptide 1
SynonymsP450-1, cytochrome P450 subfamily I, polypeptide 1
MMRRC Submission 041673-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.138) question?
Stock #R4367 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location57687928-57703824 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 57700149 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 20 (V20A)
Ref Sequence ENSEMBL: ENSMUSP00000150277 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034865] [ENSMUST00000216433]
Predicted Effect probably benign
Transcript: ENSMUST00000034865
AA Change: V20A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000034865
Gene: ENSMUSG00000032315
AA Change: V20A

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:p450 44 509 2.3e-111 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000216433
AA Change: V20A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.1512 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene, CYP1A1, encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the endoplasmic reticulum and its expression is induced by some polycyclic aromatic hydrocarbons (PAHs), some of which are found in cigarette smoke. The enzyme's endogenous substrate is unknown; however, it is able to metabolize some PAHs to carcinogenic intermediates. The gene has been associated with lung cancer risk. A related family member, CYP1A2, is located approximately 25 kb away from CYP1A1 on chromosome 15. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for a null allele display resitance to some signs of TCDD induced toxicity but do not display any gross abnormalities in the abscence of treatment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adrb2 T C 18: 62,179,056 I233V probably damaging Het
Alox5 T A 6: 116,460,963 Y21F possibly damaging Het
Ank2 T C 3: 126,946,149 T1942A probably benign Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
Bckdk C T 7: 127,906,419 A238V probably benign Het
Casp1 A G 9: 5,299,333 T21A probably benign Het
Ccdc39 T C 3: 33,826,522 H432R probably benign Het
Cttnbp2 A C 6: 18,405,249 C574G probably damaging Het
Dhx38 C T 8: 109,553,131 V976I probably damaging Het
Dnah6 A G 6: 73,149,484 S1287P possibly damaging Het
Dnttip2 T C 3: 122,276,497 S454P probably damaging Het
Doxl2 T C 6: 48,976,130 S330P probably damaging Het
Drp2 A T X: 134,435,135 probably benign Het
Flcn C T 11: 59,803,784 V121I possibly damaging Het
Fmo1 G C 1: 162,833,648 Y355* probably null Het
Git2 T A 5: 114,764,666 H138L probably damaging Het
Gpr162 G A 6: 124,861,695 probably benign Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Kcnt1 T C 2: 25,907,626 I881T probably damaging Het
Lama3 T A 18: 12,513,690 C1754S probably damaging Het
Mpp3 A T 11: 102,023,420 D116E probably benign Het
Myh11 T C 16: 14,218,883 D985G probably damaging Het
Necap1 T C 6: 122,887,378 V273A probably damaging Het
Nlrc5 T C 8: 94,476,564 S431P probably damaging Het
Nutm2 A T 13: 50,469,884 T206S probably benign Het
Olfr27 G A 9: 39,144,429 A110T probably damaging Het
Olfr507 C T 7: 108,621,889 L26F probably benign Het
Olfr707 GAACAACAACAA GAACAACAA 7: 106,891,360 probably benign Het
Phactr2 A G 10: 13,253,820 S235P probably damaging Het
Podnl1 G A 8: 84,127,268 R89H probably benign Het
Prpf38b T C 3: 108,911,171 Y91C probably damaging Het
Radil C T 5: 142,494,805 A632T probably benign Het
Rpap2 G A 5: 107,601,795 V62I possibly damaging Het
Sdf2 C T 11: 78,251,037 T66I probably damaging Het
Specc1 T C 11: 62,118,530 S371P probably damaging Het
Suco T C 1: 161,847,230 E416G probably damaging Het
Sys1 T C 2: 164,461,395 W10R probably damaging Het
Tarsl2 C T 7: 65,682,819 T556M probably damaging Het
Tcirg1 C T 19: 3,899,069 D407N probably damaging Het
Tefm G T 11: 80,140,330 L27I probably benign Het
Tenm2 A G 11: 36,027,398 I1845T probably benign Het
Tfam A T 10: 71,233,403 I119N probably damaging Het
Tle1 ACAGGTTTCTTCAGGTTTCTT ACAGGTTTCTT 4: 72,118,163 probably benign Het
Trpm6 T C 19: 18,827,525 I947T probably damaging Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Usp54 T C 14: 20,561,134 T1205A probably benign Het
Vmn2r25 T C 6: 123,828,537 R454G probably damaging Het
Xylb T C 9: 119,388,715 V477A probably benign Het
Other mutations in Cyp1a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00971:Cyp1a1 APN 9 57700707 missense probably damaging 1.00
IGL02427:Cyp1a1 APN 9 57700575 missense probably damaging 1.00
IGL02952:Cyp1a1 APN 9 57702710 missense probably benign
IGL03002:Cyp1a1 APN 9 57702441 splice site probably benign
IGL03085:Cyp1a1 APN 9 57701712 missense possibly damaging 0.89
PIT1430001:Cyp1a1 UTSW 9 57700911 missense probably benign 0.27
R0508:Cyp1a1 UTSW 9 57700305 missense probably benign
R1844:Cyp1a1 UTSW 9 57702697 missense probably benign
R2216:Cyp1a1 UTSW 9 57702069 splice site probably null
R2394:Cyp1a1 UTSW 9 57700149 missense probably benign 0.13
R3966:Cyp1a1 UTSW 9 57700149 missense probably benign 0.13
R4056:Cyp1a1 UTSW 9 57700149 missense probably benign 0.13
R4529:Cyp1a1 UTSW 9 57701679 missense probably benign 0.01
R4616:Cyp1a1 UTSW 9 57701756 missense probably benign 0.09
R4656:Cyp1a1 UTSW 9 57702610 missense probably damaging 0.99
R5271:Cyp1a1 UTSW 9 57702838 missense probably benign 0.01
R5324:Cyp1a1 UTSW 9 57702369 missense probably benign 0.13
R6113:Cyp1a1 UTSW 9 57701891 missense probably damaging 1.00
R6189:Cyp1a1 UTSW 9 57700683 missense probably damaging 1.00
R6239:Cyp1a1 UTSW 9 57702078 missense probably benign 0.36
R6382:Cyp1a1 UTSW 9 57700690 missense probably damaging 0.99
R6750:Cyp1a1 UTSW 9 57700256 missense probably benign
R6869:Cyp1a1 UTSW 9 57702784 missense probably benign
R6881:Cyp1a1 UTSW 9 57700719 missense possibly damaging 0.78
R6913:Cyp1a1 UTSW 9 57700293 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ACAAGCTCTGTCCTGCTCTATG -3'
(R):5'- TGATAAGTGTGAAGCTGTAGAGGTC -3'

Sequencing Primer
(F):5'- TCTATGCCCAGGGAACAGCTC -3'
(R):5'- AAGCTGTAGAGGTCTGGCC -3'
Posted On2015-07-06