Incidental Mutation 'R4367:Adrb2'
ID325829
Institutional Source Beutler Lab
Gene Symbol Adrb2
Ensembl Gene ENSMUSG00000045730
Gene Nameadrenergic receptor, beta 2
SynonymsGpcr7, beta 2-AR, Adrb-2, beta 2-adrenoceptor, Badm
MMRRC Submission 041673-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4367 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location62177817-62179959 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 62179056 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 233 (I233V)
Ref Sequence ENSEMBL: ENSMUSP00000062256 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053640] [ENSMUST00000067743]
Predicted Effect probably damaging
Transcript: ENSMUST00000053640
AA Change: I233V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000062256
Gene: ENSMUSG00000045730
AA Change: I233V

DomainStartEndE-ValueType
Pfam:7tm_4 40 246 4.7e-10 PFAM
Pfam:7TM_GPCR_Srx 41 250 2.2e-8 PFAM
Pfam:7TM_GPCR_Srsx 43 340 1.4e-15 PFAM
Pfam:7tm_1 50 326 9.8e-74 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000067743
SMART Domains Protein: ENSMUSP00000065944
Gene: ENSMUSG00000054589

DomainStartEndE-ValueType
low complexity region 53 69 N/A INTRINSIC
Meta Mutation Damage Score 0.25 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: This intronless gene belongs to the G-protein-coupled receptor superfamily, which includes transmembrane proteins that play a role in signal transduction across biological membranes resulting in a variety of physiological responses. The encoded protein is a beta-2 adrenergic receptor which is activated by catecholamine ligands such as adrenaline and epinephrine. The protein participates in the classical signaling pathway involving G protein, adenylyl cyclase, cAMP (3'-5'-cyclic adenosine monophosphate) and protein kinase A (PKA). In humans, this gene is implicated in susceptibility to nocturnal asthma, obesity and type 2 diabetes. [provided by RefSeq, Apr 2013]
PHENOTYPE: Mice homozygous for targeted mutations that inactivate the gene exhibit increased bone mass. The primary physiological consequences are seen during exercise stress and result from alterations in vascular tone and energy metabolism. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alox5 T A 6: 116,460,963 Y21F possibly damaging Het
Ank2 T C 3: 126,946,149 T1942A probably benign Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
Bckdk C T 7: 127,906,419 A238V probably benign Het
Casp1 A G 9: 5,299,333 T21A probably benign Het
Ccdc39 T C 3: 33,826,522 H432R probably benign Het
Cttnbp2 A C 6: 18,405,249 C574G probably damaging Het
Cyp1a1 T C 9: 57,700,149 V20A probably benign Het
Dhx38 C T 8: 109,553,131 V976I probably damaging Het
Dnah6 A G 6: 73,149,484 S1287P possibly damaging Het
Dnttip2 T C 3: 122,276,497 S454P probably damaging Het
Doxl2 T C 6: 48,976,130 S330P probably damaging Het
Drp2 A T X: 134,435,135 probably benign Het
Flcn C T 11: 59,803,784 V121I possibly damaging Het
Fmo1 G C 1: 162,833,648 Y355* probably null Het
Git2 T A 5: 114,764,666 H138L probably damaging Het
Gpr162 G A 6: 124,861,695 probably benign Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Kcnt1 T C 2: 25,907,626 I881T probably damaging Het
Lama3 T A 18: 12,513,690 C1754S probably damaging Het
Mpp3 A T 11: 102,023,420 D116E probably benign Het
Myh11 T C 16: 14,218,883 D985G probably damaging Het
Necap1 T C 6: 122,887,378 V273A probably damaging Het
Nlrc5 T C 8: 94,476,564 S431P probably damaging Het
Nutm2 A T 13: 50,469,884 T206S probably benign Het
Olfr27 G A 9: 39,144,429 A110T probably damaging Het
Olfr507 C T 7: 108,621,889 L26F probably benign Het
Olfr707 GAACAACAACAA GAACAACAA 7: 106,891,360 probably benign Het
Phactr2 A G 10: 13,253,820 S235P probably damaging Het
Podnl1 G A 8: 84,127,268 R89H probably benign Het
Prpf38b T C 3: 108,911,171 Y91C probably damaging Het
Radil C T 5: 142,494,805 A632T probably benign Het
Rpap2 G A 5: 107,601,795 V62I possibly damaging Het
Sdf2 C T 11: 78,251,037 T66I probably damaging Het
Specc1 T C 11: 62,118,530 S371P probably damaging Het
Suco T C 1: 161,847,230 E416G probably damaging Het
Sys1 T C 2: 164,461,395 W10R probably damaging Het
Tarsl2 C T 7: 65,682,819 T556M probably damaging Het
Tcirg1 C T 19: 3,899,069 D407N probably damaging Het
Tefm G T 11: 80,140,330 L27I probably benign Het
Tenm2 A G 11: 36,027,398 I1845T probably benign Het
Tfam A T 10: 71,233,403 I119N probably damaging Het
Tle1 ACAGGTTTCTTCAGGTTTCTT ACAGGTTTCTT 4: 72,118,163 probably benign Het
Trpm6 T C 19: 18,827,525 I947T probably damaging Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Usp54 T C 14: 20,561,134 T1205A probably benign Het
Vmn2r25 T C 6: 123,828,537 R454G probably damaging Het
Xylb T C 9: 119,388,715 V477A probably benign Het
Other mutations in Adrb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02336:Adrb2 APN 18 62179007 missense probably benign 0.00
PIT4514001:Adrb2 UTSW 18 62179727 missense probably benign 0.00
R0091:Adrb2 UTSW 18 62179019 missense probably benign
R0420:Adrb2 UTSW 18 62179539 missense possibly damaging 0.76
R0436:Adrb2 UTSW 18 62179553 missense possibly damaging 0.93
R0604:Adrb2 UTSW 18 62178515 missense possibly damaging 0.49
R0626:Adrb2 UTSW 18 62179370 missense probably damaging 1.00
R0843:Adrb2 UTSW 18 62179071 missense probably benign 0.03
R0940:Adrb2 UTSW 18 62179691 missense probably benign 0.00
R1498:Adrb2 UTSW 18 62178933 missense probably damaging 1.00
R1517:Adrb2 UTSW 18 62178800 missense probably damaging 1.00
R1603:Adrb2 UTSW 18 62179508 missense probably damaging 1.00
R1944:Adrb2 UTSW 18 62179413 missense probably damaging 1.00
R5143:Adrb2 UTSW 18 62178776 missense probably damaging 1.00
R5468:Adrb2 UTSW 18 62179625 missense probably damaging 1.00
R5644:Adrb2 UTSW 18 62178682 missense probably benign 0.01
R6073:Adrb2 UTSW 18 62179466 missense probably benign 0.01
R6753:Adrb2 UTSW 18 62179553 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- TGTCCCTGATAACGTGCACG -3'
(R):5'- TTGCCTATCCAGATGCACTG -3'

Sequencing Primer
(F):5'- GTCCCTGATAACGTGCACGATATTG -3'
(R):5'- AGATGCACTGGTACCGTGC -3'
Posted On2015-07-06