Incidental Mutation 'R1317:Tspan32'
ID157566
Institutional Source Beutler Lab
Gene Symbol Tspan32
Ensembl Gene ENSMUSG00000000244
Gene Nametetraspanin 32
SynonymsArt-1, Tssc6, Phemx, Tspan32, D7Wsu37e
MMRRC Submission 039383-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1317 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location143005046-143019644 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 143017591 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 159 (M159V)
Ref Sequence ENSEMBL: ENSMUSP00000115344 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009396] [ENSMUST00000075172] [ENSMUST00000082008] [ENSMUST00000105923] [ENSMUST00000105924] [ENSMUST00000105925] [ENSMUST00000143512] [ENSMUST00000145212] [ENSMUST00000207211]
Predicted Effect probably benign
Transcript: ENSMUST00000009396
AA Change: M214V

PolyPhen 2 Score 0.271 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000009396
Gene: ENSMUSG00000000244
AA Change: M214V

DomainStartEndE-ValueType
Pfam:Tetraspannin 9 223 3.2e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000075172
AA Change: M187V

PolyPhen 2 Score 0.076 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000074667
Gene: ENSMUSG00000000244
AA Change: M187V

DomainStartEndE-ValueType
Pfam:Tetraspannin 1 198 3.1e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000082008
AA Change: M159V

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000080668
Gene: ENSMUSG00000000244
AA Change: M159V

DomainStartEndE-ValueType
Pfam:Tetraspannin 1 146 7.1e-13 PFAM
transmembrane domain 155 174 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105923
AA Change: M125V

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000101543
Gene: ENSMUSG00000000244
AA Change: M125V

DomainStartEndE-ValueType
transmembrane domain 33 55 N/A INTRINSIC
transmembrane domain 62 84 N/A INTRINSIC
transmembrane domain 121 140 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105924
SMART Domains Protein: ENSMUSP00000101544
Gene: ENSMUSG00000000244

DomainStartEndE-ValueType
Pfam:Tetraspannin 1 148 1.8e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105925
SMART Domains Protein: ENSMUSP00000101545
Gene: ENSMUSG00000000244

DomainStartEndE-ValueType
transmembrane domain 33 55 N/A INTRINSIC
transmembrane domain 65 87 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133630
Predicted Effect probably benign
Transcript: ENSMUST00000143512
AA Change: M159V

PolyPhen 2 Score 0.370 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000115344
Gene: ENSMUSG00000000244
AA Change: M159V

DomainStartEndE-ValueType
transmembrane domain 29 51 N/A INTRINSIC
transmembrane domain 146 168 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000145212
SMART Domains Protein: ENSMUSP00000116212
Gene: ENSMUSG00000000244

DomainStartEndE-ValueType
transmembrane domain 33 55 N/A INTRINSIC
transmembrane domain 62 84 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154264
Predicted Effect probably benign
Transcript: ENSMUST00000207211
AA Change: M99V

PolyPhen 2 Score 0.101 (Sensitivity: 0.93; Specificity: 0.86)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.5%
  • 10x: 93.7%
  • 20x: 84.9%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene, which is a member of the tetraspanin superfamily, is one of several tumor-suppressing subtransferable fragments located in the imprinted gene domain of chromosome 11p15.5, an important tumor-suppressor gene region. Alterations in this region have been associated with Beckwith-Wiedemann syndrome, Wilms tumor, rhabdomyosarcoma, adrenocortical carcinoma, and lung, ovarian and breast cancers. This gene is located among several imprinted genes; however, this gene, as well as the tumor-suppressing subchromosomal transferable fragment 4, escapes imprinting. This gene may play a role in malignancies and diseases that involve this region, and it is also involved in hematopoietic cell function. Alternatively spliced transcript variants have been described, but their biological validity has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap null mutation exhibit normal hematopoiesis, hemolytic and granulopoitic responses. B cells exhibit normal proliferative responses while T cells demonstrate enhanced proliferation upon T cell receptor stimulation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi3bp C T 16: 56,668,309 H1268Y possibly damaging Het
Afdn A G 17: 13,846,273 T576A probably benign Het
Bcl6 G T 16: 23,977,542 A45D probably damaging Het
Ccdc7b A T 8: 129,136,646 H223L probably benign Het
Cdh15 G C 8: 122,857,495 E112Q probably damaging Het
Cryba2 G T 1: 74,890,676 probably null Het
Depdc1a T C 3: 159,523,287 C559R probably damaging Het
Fam20a A T 11: 109,677,838 N287K probably damaging Het
Gm5519 T C 19: 33,824,991 Y145H possibly damaging Het
Gm9602 T A 14: 4,776,499 I28N probably damaging Het
Gmeb1 G A 4: 132,234,887 Q154* probably null Het
Gpr156 T C 16: 37,987,567 L192P probably damaging Het
Hnrnpu G A 1: 178,330,257 probably benign Het
Ifi209 A G 1: 173,637,463 D53G possibly damaging Het
Irf6 G A 1: 193,169,301 R400H probably damaging Het
Jag2 T A 12: 112,914,501 M537L probably benign Het
Mid1 A C X: 169,986,094 N215H probably damaging Het
Mt1 T C 8: 94,180,153 probably benign Het
Myo15b C A 11: 115,883,634 P2024Q probably null Het
Nphs1 C T 7: 30,481,831 probably benign Het
Rbm27 G A 18: 42,324,051 probably benign Het
Robo2 A G 16: 74,035,024 V256A probably damaging Het
Rps24 A G 14: 24,491,762 T6A probably damaging Het
Scg3 G A 9: 75,669,340 T251M probably damaging Het
Slc25a23 T C 17: 57,053,888 K179E possibly damaging Het
Smad5 T C 13: 56,736,071 probably benign Het
Tom1 T C 8: 75,051,551 V87A probably benign Het
Trim30b T A 7: 104,357,335 T105S possibly damaging Het
Tubb1 A G 2: 174,456,896 S124G probably benign Het
Zbtb1 A G 12: 76,386,799 S520G probably benign Het
Zdhhc7 T A 8: 120,084,900 H188L probably benign Het
Other mutations in Tspan32
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01466:Tspan32 APN 7 143014954 intron probably benign
IGL02122:Tspan32 APN 7 143015635 missense probably damaging 0.99
IGL02830:Tspan32 APN 7 143017592 missense possibly damaging 0.93
theron UTSW 7 143017591 missense probably benign 0.37
R0594:Tspan32 UTSW 7 143015610 missense probably damaging 0.98
R1162:Tspan32 UTSW 7 143006998 missense probably damaging 1.00
R1513:Tspan32 UTSW 7 143005149 missense probably null 0.05
R2941:Tspan32 UTSW 7 143014992 missense probably damaging 1.00
R3953:Tspan32 UTSW 7 143006998 missense probably damaging 1.00
R3955:Tspan32 UTSW 7 143006998 missense probably damaging 1.00
R3957:Tspan32 UTSW 7 143006998 missense probably damaging 1.00
R5021:Tspan32 UTSW 7 143014978 missense probably damaging 1.00
R5849:Tspan32 UTSW 7 143015587 missense probably damaging 1.00
R6429:Tspan32 UTSW 7 143018742 missense possibly damaging 0.59
R7205:Tspan32 UTSW 7 143005126 missense possibly damaging 0.66
R7756:Tspan32 UTSW 7 143017222 missense probably benign 0.32
R8218:Tspan32 UTSW 7 143011095 missense probably benign 0.03
R8412:Tspan32 UTSW 7 143005958 missense probably benign
Predicted Primers PCR Primer
(F):5'- GTTGAGCAAACCATGCAGCTCC -3'
(R):5'- TTCCAGGGCAGAGGTAACACATCG -3'

Sequencing Primer
(F):5'- TTCCCAGGTAGAAGCAGTCC -3'
(R):5'- CGGTGGTGGGAGAGAAAGATAC -3'
Posted On2014-02-18