Mutagenetix > Incidental Mutation

Incidental Mutation 'R1317:Slc25a23'

157585

Institutional Source

Beutler Lab

Gene Symbol

Slc25a23

Ensembl Gene

ENSMUSG00000046329

Gene Name

solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 23

Synonyms

MMRRC Submission

039383-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1317 (G1)

Quality Score

143

Status

Validated

Chromosome

Chromosomal Location

57043711-57059863 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 57053888 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Glutamic Acid at position 179 (K179E)

Ref Sequence

ENSEMBL: ENSMUSP00000040198 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000040280] [ENSMUST00000171528]

AlphaFold

Q6GQS1

Predicted Effect

possibly damaging
Transcript: ENSMUST00000040280
AA Change: K179E

PolyPhen 2 Score 0.633 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000040198
Gene: ENSMUSG00000046329
AA Change: K179E

Domain	Start	End	E-Value	Type
EFh	13	41	2.72e-3	SMART
EFh	80	108	1.09e0	SMART
EFh	116	144	3.07e1	SMART
Pfam:Mito_carr	181	273	3.8e-25	PFAM
Pfam:Mito_carr	274	366	4.1e-26	PFAM
Pfam:Mito_carr	372	465	6.5e-21	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000163442

SMART Domains

Protein: ENSMUSP00000132962
Gene: ENSMUSG00000046329

Domain	Start	End	E-Value	Type
Pfam:Mito_carr	1	58	6.5e-15	PFAM
Pfam:Mito_carr	64	123	1.9e-7	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000165187

Predicted Effect

probably benign
Transcript: ENSMUST00000170015

SMART Domains

Protein: ENSMUSP00000132169
Gene: ENSMUSG00000046329

Domain	Start	End	E-Value	Type
Pfam:Mito_carr	1	76	1.9e-19	PFAM
Pfam:Mito_carr	77	166	1.2e-21	PFAM
Pfam:Mito_carr	172	265	7.6e-22	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000171128

Predicted Effect

probably benign
Transcript: ENSMUST00000171528

SMART Domains

Protein: ENSMUSP00000128348
Gene: ENSMUSG00000046329

Domain	Start	End	E-Value	Type
Pfam:Mito_carr	22	114	8.3e-29	PFAM

Meta Mutation Damage Score

0.1896

Coding Region Coverage

1x: 98.7%
3x: 97.5%
10x: 93.7%
20x: 84.9%

Validation Efficiency

100% (42/42)

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired mitochondrial function. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 31 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abi3bp	C	T	16: 56,668,309	H1268Y	possibly damaging	Het
Afdn	A	G	17: 13,846,273	T576A	probably benign	Het
Bcl6	G	T	16: 23,977,542	A45D	probably damaging	Het
Ccdc7b	A	T	8: 129,136,646	H223L	probably benign	Het
Cdh15	G	C	8: 122,857,495	E112Q	probably damaging	Het
Cryba2	G	T	1: 74,890,676		probably null	Het
Depdc1a	T	C	3: 159,523,287	C559R	probably damaging	Het
Fam20a	A	T	11: 109,677,838	N287K	probably damaging	Het
Gm5519	T	C	19: 33,824,991	Y145H	possibly damaging	Het
Gm9602	T	A	14: 4,776,499	I28N	probably damaging	Het
Gmeb1	G	A	4: 132,234,887	Q154*	probably null	Het
Gpr156	T	C	16: 37,987,567	L192P	probably damaging	Het
Hnrnpu	G	A	1: 178,330,257		probably benign	Het
Ifi209	A	G	1: 173,637,463	D53G	possibly damaging	Het
Irf6	G	A	1: 193,169,301	R400H	probably damaging	Het
Jag2	T	A	12: 112,914,501	M537L	probably benign	Het
Mid1	A	C	X: 169,986,094	N215H	probably damaging	Het
Mt1	T	C	8: 94,180,153		probably benign	Het
Myo15b	C	A	11: 115,883,634	P2024Q	probably null	Het
Nphs1	C	T	7: 30,481,831		probably benign	Het
Rbm27	G	A	18: 42,324,051		probably benign	Het
Robo2	A	G	16: 74,035,024	V256A	probably damaging	Het
Rps24	A	G	14: 24,491,762	T6A	probably damaging	Het
Scg3	G	A	9: 75,669,340	T251M	probably damaging	Het
Smad5	T	C	13: 56,736,071		probably benign	Het
Tom1	T	C	8: 75,051,551	V87A	probably benign	Het
Trim30b	T	A	7: 104,357,335	T105S	possibly damaging	Het
Tspan32	A	G	7: 143,017,591	M159V	probably benign	Het
Tubb1	A	G	2: 174,456,896	S124G	probably benign	Het
Zbtb1	A	G	12: 76,386,799	S520G	probably benign	Het
Zdhhc7	T	A	8: 120,084,900	H188L	probably benign	Het

Other mutations in Slc25a23

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01090:Slc25a23	APN	17	57047233	missense	probably benign	0.01
IGL01614:Slc25a23	APN	17	57045579	missense	probably null	0.98
IGL01919:Slc25a23	APN	17	57047291	missense	possibly damaging	0.61
IGL01933:Slc25a23	APN	17	57052813	nonsense	probably null
IGL02297:Slc25a23	APN	17	57053324	missense	probably benign	0.00
R1411:Slc25a23	UTSW	17	57059622	missense	probably damaging	0.97
R1577:Slc25a23	UTSW	17	57047306	missense	probably benign	0.00
R2156:Slc25a23	UTSW	17	57045562	missense	probably benign	0.00
R4581:Slc25a23	UTSW	17	57052740	missense	probably damaging	0.96
R4755:Slc25a23	UTSW	17	57052794	missense	possibly damaging	0.92
R4786:Slc25a23	UTSW	17	57047326	missense	possibly damaging	0.68
R4789:Slc25a23	UTSW	17	57059597	missense	probably damaging	1.00
R5402:Slc25a23	UTSW	17	57053336	missense	probably benign	0.07
R5423:Slc25a23	UTSW	17	57053597	missense	probably damaging	0.99
R5478:Slc25a23	UTSW	17	57052780	missense	probably damaging	1.00
R5659:Slc25a23	UTSW	17	57045500	unclassified	probably benign
R5787:Slc25a23	UTSW	17	57053825	missense	probably damaging	1.00
R6417:Slc25a23	UTSW	17	57052780	missense	probably damaging	0.98
R6420:Slc25a23	UTSW	17	57052780	missense	probably damaging	0.98
R6462:Slc25a23	UTSW	17	57052720	missense	probably damaging	1.00
R6830:Slc25a23	UTSW	17	57053804	nonsense	probably null
R6858:Slc25a23	UTSW	17	57058171	missense	probably damaging	1.00
R7311:Slc25a23	UTSW	17	57052827	missense	probably damaging	1.00
R7381:Slc25a23	UTSW	17	57053587	missense	probably damaging	1.00
R7491:Slc25a23	UTSW	17	57052822	nonsense	probably null
R7543:Slc25a23	UTSW	17	57058106	critical splice donor site	probably null
R7646:Slc25a23	UTSW	17	57059759	unclassified	probably benign
R8879:Slc25a23	UTSW	17	57059709	unclassified	probably benign
R9042:Slc25a23	UTSW	17	57045553	missense	probably damaging	1.00
R9076:Slc25a23	UTSW	17	57047309	missense	probably benign	0.00
R9399:Slc25a23	UTSW	17	57053930	missense	probably damaging	1.00
X0026:Slc25a23	UTSW	17	57055350	missense	probably benign	0.09

Predicted Primers

PCR Primer
(F):5'- TTGAGCACGTTGATGCCGTTGC -3'
(R):5'- TCGGGAGATCCAGAGATGTTCACC -3'

Sequencing Primer
(F):5'- TCAGGCCCCCTAGAATGTTAAG -3'
(R):5'- CCATTGGGAAATCTATTGCTGGAC -3'

Posted On

2014-02-18