Incidental Mutation 'R1449:Col3a1'
ID 159092
Institutional Source Beutler Lab
Gene Symbol Col3a1
Ensembl Gene ENSMUSG00000026043
Gene Name collagen, type III, alpha 1
Synonyms Col3a-1
MMRRC Submission 039504-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.893) question?
Stock # R1449 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 45311538-45349706 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 45321611 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 67 (I67N)
Ref Sequence ENSEMBL: ENSMUSP00000085192 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087883]
AlphaFold P08121
Predicted Effect unknown
Transcript: ENSMUST00000087883
AA Change: I67N
SMART Domains Protein: ENSMUSP00000085192
Gene: ENSMUSG00000026043
AA Change: I67N

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
VWC 33 89 2.73e-20 SMART
low complexity region 100 140 N/A INTRINSIC
low complexity region 163 227 N/A INTRINSIC
low complexity region 230 248 N/A INTRINSIC
internal_repeat_2 249 284 3.45e-13 PROSPERO
internal_repeat_1 250 290 1.9e-17 PROSPERO
Pfam:Collagen 293 366 7.3e-9 PFAM
low complexity region 368 419 N/A INTRINSIC
internal_repeat_4 423 476 2.52e-11 PROSPERO
internal_repeat_1 427 488 1.9e-17 PROSPERO
internal_repeat_3 427 491 7.39e-12 PROSPERO
internal_repeat_2 456 491 3.45e-13 PROSPERO
Pfam:Collagen 533 592 2.6e-11 PFAM
low complexity region 632 680 N/A INTRINSIC
low complexity region 683 776 N/A INTRINSIC
low complexity region 784 815 N/A INTRINSIC
low complexity region 818 855 N/A INTRINSIC
low complexity region 865 921 N/A INTRINSIC
low complexity region 925 950 N/A INTRINSIC
low complexity region 953 974 N/A INTRINSIC
internal_repeat_4 975 1028 2.52e-11 PROSPERO
internal_repeat_3 976 1029 7.39e-12 PROSPERO
internal_repeat_5 977 991 3.33e-5 PROSPERO
internal_repeat_5 1019 1033 3.33e-5 PROSPERO
low complexity region 1037 1058 N/A INTRINSIC
Pfam:Collagen 1076 1135 5.6e-13 PFAM
Pfam:Collagen 1136 1209 4.3e-11 PFAM
COLFI 1229 1464 5.73e-166 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129611
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189818
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.9%
  • 10x: 94.7%
  • 20x: 87.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes the alpha-1 subunit of the fibril-forming type III collagen found in bone, cartilage, dentin, tendon, bone marrow stroma and other connective tissue. The encoded protein forms homotrimeric type III procollagen that undergoes proteolytic processing during fibril formation. A majority of mice lacking the encoded protein die within two days of birth but about 5% of the animals survive to adulthood. The surviving mice exhibit severe cortical malformation and experience significantly shorter lifespan. The mutant mouse named "tight skin 2" exhibiting systemic sclerosis phenotype was found to harbor a missense point mutation in this gene. A pseudogene of this gene has been defined on chromosome 8. [provided by RefSeq, Nov 2015]
PHENOTYPE: Most homozygous mutants die within 48 hours after birth. Surviving mutants have reduced body size, skin lesions, enlarged intestines, and die by 6 months of age from ruptured blood vessels. Occasionally intestinal rupture also results in early death. Heterozygotes exhibit tight skin. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013G24Rik A G 4: 137,455,355 N274D possibly damaging Het
6430571L13Rik T A 9: 107,342,490 N47K probably damaging Het
Aasdh C T 5: 76,886,289 A472T probably benign Het
Abca13 A G 11: 9,298,580 T2776A probably damaging Het
Adamts10 T A 17: 33,545,639 V711D probably damaging Het
Adrb3 G A 8: 27,227,387 R345C probably damaging Het
Ak7 T C 12: 105,742,261 V325A possibly damaging Het
Armc6 G A 8: 70,225,293 L129F probably benign Het
Bend6 T C 1: 33,878,343 N10S probably benign Het
Bmpr1b T C 3: 141,871,373 E59G possibly damaging Het
Brd3 A G 2: 27,450,251 probably null Het
Brd3 A G 2: 27,457,016 Y369H probably damaging Het
Cacna1e C T 1: 154,485,662 probably null Het
Camk4 A G 18: 32,939,475 D27G probably damaging Het
Camkk1 T G 11: 73,033,884 S308A probably damaging Het
Catsperb A G 12: 101,588,197 T717A probably benign Het
Cdh23 A T 10: 60,376,951 S1563R probably damaging Het
Cep44 A T 8: 56,540,950 S197R probably benign Het
Dcaf12l1 T C X: 44,789,427 T165A probably benign Het
Dicer1 T C 12: 104,729,243 Y143C possibly damaging Het
Dlg5 A G 14: 24,135,643 I1898T possibly damaging Het
Dnah1 T C 14: 31,263,951 N3762D probably damaging Het
Dscaml1 A T 9: 45,742,223 T1382S possibly damaging Het
Entpd3 A T 9: 120,566,489 R513W probably damaging Het
Foxred1 A G 9: 35,209,442 S132P probably damaging Het
Ftsj3 T C 11: 106,253,000 I273V probably benign Het
Hsd17b7 C T 1: 169,959,682 probably null Het
Iars T A 13: 49,733,710 V1253D probably damaging Het
Iqsec1 T A 6: 90,690,808 K216* probably null Het
Itga7 A G 10: 128,953,501 D971G probably benign Het
Kcnk2 G A 1: 189,340,026 S35L probably benign Het
Kif13a T C 13: 46,812,736 Y402C probably damaging Het
Lamc1 A G 1: 153,250,495 S484P probably benign Het
Lap3 T C 5: 45,509,519 probably null Het
Lhx8 G T 3: 154,328,105 S46* probably null Het
Lin7a T C 10: 107,323,952 S42P probably damaging Het
Lrba G A 3: 86,354,278 R1513Q probably damaging Het
Maml2 C A 9: 13,620,684 P398Q possibly damaging Het
Mast2 T C 4: 116,309,013 I1201V probably damaging Het
Mmp20 A T 9: 7,642,768 D201V probably damaging Het
Morn5 T A 2: 36,057,080 C123* probably null Het
Mrpl4 A G 9: 21,007,511 K175E possibly damaging Het
Nav3 A T 10: 109,853,511 S302T probably benign Het
Ndrg2 T C 14: 51,908,134 Y217C probably damaging Het
Nfx1 A G 4: 40,976,803 D159G probably damaging Het
Nlrp9b A T 7: 20,023,164 T109S possibly damaging Het
Npepps A G 11: 97,207,154 Y909H probably benign Het
Olfr1510 A G 14: 52,410,567 C102R probably damaging Het
Olfr559 A T 7: 102,724,190 F100Y probably damaging Het
Olfr740 A G 14: 50,453,921 N290D probably damaging Het
Olfr801 T A 10: 129,670,369 D50V probably damaging Het
Olfr810 A C 10: 129,790,854 V245G probably damaging Het
Pcdh1 T C 18: 38,189,876 H968R probably damaging Het
Pde1b T A 15: 103,525,043 I296N probably damaging Het
Phldb1 T A 9: 44,716,633 T172S probably benign Het
Plxdc2 T C 2: 16,660,781 V215A possibly damaging Het
Poln A G 5: 34,014,338 I695T probably damaging Het
Pou6f2 G T 13: 18,172,415 Q31K probably damaging Het
Psd T A 19: 46,324,811 Y40F probably damaging Het
Rnf126 T C 10: 79,761,614 N155D probably benign Het
Rpl36-ps3 C A 12: 12,912,031 noncoding transcript Het
Rrp15 C A 1: 186,736,268 V184F possibly damaging Het
Rslcan18 G T 13: 67,102,100 L24M possibly damaging Het
Sall1 A G 8: 89,032,483 I331T probably benign Het
Slamf7 A T 1: 171,641,038 N95K possibly damaging Het
Slc1a6 T C 10: 78,800,117 Y339H probably damaging Het
Slc39a8 A G 3: 135,826,685 N72D probably benign Het
Slf1 A G 13: 77,083,449 S604P probably damaging Het
Slfn4 C T 11: 83,188,993 T110M probably benign Het
Tnpo1 T C 13: 98,878,712 T116A probably damaging Het
Tor1b T C 2: 30,955,881 I190T probably damaging Het
Ttn C A 2: 76,969,794 E357* probably null Het
Tubg2 G T 11: 101,156,873 E95* probably null Het
Ubap2 A G 4: 41,209,351 probably null Het
Ube2i T C 17: 25,268,564 D67G possibly damaging Het
Ubxn11 A G 4: 134,124,892 E50G probably damaging Het
Wnk1 A G 6: 119,952,818 V1246A probably damaging Het
Zcchc7 A G 4: 44,929,124 T38A possibly damaging Het
Zfp236 A G 18: 82,646,005 S552P probably damaging Het
Other mutations in Col3a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00504:Col3a1 APN 1 45347135 missense probably damaging 1.00
IGL00928:Col3a1 APN 1 45340858 intron probably benign
IGL00958:Col3a1 APN 1 45327595 missense unknown
IGL01353:Col3a1 APN 1 45333638 unclassified probably benign
IGL01820:Col3a1 APN 1 45321608 missense unknown
IGL01839:Col3a1 APN 1 45311830 missense unknown
IGL02517:Col3a1 APN 1 45325803 critical splice acceptor site probably null
IGL02879:Col3a1 APN 1 45340959 intron probably benign
IGL02960:Col3a1 APN 1 45328455 missense unknown
IGL03245:Col3a1 APN 1 45331109 unclassified probably benign
IGL03308:Col3a1 APN 1 45330617 splice site probably benign
Creation UTSW 1 45345984 missense probably damaging 1.00
Kraken UTSW 1 45327866 splice site probably null
Wealth UTSW 1 45340312 splice site probably benign
IGL03050:Col3a1 UTSW 1 45328925 splice site probably null
PIT4520001:Col3a1 UTSW 1 45335783 critical splice donor site probably null
R0063:Col3a1 UTSW 1 45330541 splice site probably benign
R0122:Col3a1 UTSW 1 45340897 intron probably benign
R0131:Col3a1 UTSW 1 45328868 splice site probably benign
R0762:Col3a1 UTSW 1 45321526 missense unknown
R0765:Col3a1 UTSW 1 45336651 unclassified probably benign
R0853:Col3a1 UTSW 1 45343324 intron probably benign
R0898:Col3a1 UTSW 1 45333993 unclassified probably benign
R1170:Col3a1 UTSW 1 45327601 missense unknown
R1170:Col3a1 UTSW 1 45347724 missense probably damaging 1.00
R1440:Col3a1 UTSW 1 45343312 splice site probably null
R1526:Col3a1 UTSW 1 45321688 missense unknown
R1572:Col3a1 UTSW 1 45345968 missense possibly damaging 0.95
R1585:Col3a1 UTSW 1 45327866 splice site probably null
R1616:Col3a1 UTSW 1 45328488 critical splice donor site probably null
R1691:Col3a1 UTSW 1 45348616 unclassified probably benign
R1876:Col3a1 UTSW 1 45342235 splice site probably null
R1937:Col3a1 UTSW 1 45334293 unclassified probably benign
R2093:Col3a1 UTSW 1 45332990 missense probably damaging 1.00
R2110:Col3a1 UTSW 1 45330145 missense unknown
R2119:Col3a1 UTSW 1 45346121 missense probably damaging 1.00
R2256:Col3a1 UTSW 1 45321632 missense unknown
R2327:Col3a1 UTSW 1 45338611 unclassified probably benign
R2518:Col3a1 UTSW 1 45337512 unclassified probably benign
R2991:Col3a1 UTSW 1 45335779 unclassified probably benign
R3405:Col3a1 UTSW 1 45338753 unclassified probably benign
R3784:Col3a1 UTSW 1 45347135 missense probably damaging 1.00
R3847:Col3a1 UTSW 1 45321990 missense unknown
R3848:Col3a1 UTSW 1 45321990 missense unknown
R3849:Col3a1 UTSW 1 45321990 missense unknown
R4502:Col3a1 UTSW 1 45348677 unclassified probably benign
R4503:Col3a1 UTSW 1 45348677 unclassified probably benign
R4764:Col3a1 UTSW 1 45346110 missense probably damaging 1.00
R4839:Col3a1 UTSW 1 45323803 splice site probably null
R4934:Col3a1 UTSW 1 45339952 unclassified probably benign
R5033:Col3a1 UTSW 1 45346110 missense probably damaging 1.00
R5123:Col3a1 UTSW 1 45333596 unclassified probably benign
R5190:Col3a1 UTSW 1 45329084 missense unknown
R5190:Col3a1 UTSW 1 45344807 intron probably benign
R5375:Col3a1 UTSW 1 45347899 splice site probably null
R5407:Col3a1 UTSW 1 45346052 missense probably benign 0.03
R5627:Col3a1 UTSW 1 45331560 unclassified probably benign
R5642:Col3a1 UTSW 1 45331712 unclassified probably benign
R6014:Col3a1 UTSW 1 45321579 nonsense probably null
R6052:Col3a1 UTSW 1 45345013 unclassified probably benign
R6263:Col3a1 UTSW 1 45321575 missense unknown
R6453:Col3a1 UTSW 1 45339378 unclassified probably benign
R6463:Col3a1 UTSW 1 45342205 intron probably benign
R6488:Col3a1 UTSW 1 45331534 unclassified probably benign
R6525:Col3a1 UTSW 1 45347179 missense possibly damaging 0.88
R6637:Col3a1 UTSW 1 45347730 missense probably damaging 1.00
R6704:Col3a1 UTSW 1 45347732 missense probably damaging 1.00
R6744:Col3a1 UTSW 1 45338622 unclassified probably benign
R6745:Col3a1 UTSW 1 45338622 unclassified probably benign
R6747:Col3a1 UTSW 1 45338622 unclassified probably benign
R6858:Col3a1 UTSW 1 45345984 missense probably damaging 1.00
R6903:Col3a1 UTSW 1 45331988 missense probably damaging 0.96
R7189:Col3a1 UTSW 1 45333657 missense unknown
R7194:Col3a1 UTSW 1 45331700 missense unknown
R7199:Col3a1 UTSW 1 45332141 missense probably null 0.99
R7204:Col3a1 UTSW 1 45322418 missense unknown
R7304:Col3a1 UTSW 1 45347811 missense unknown
R7378:Col3a1 UTSW 1 45327647 splice site probably null
R7398:Col3a1 UTSW 1 45327813 missense unknown
R7742:Col3a1 UTSW 1 45345001 missense unknown
R8072:Col3a1 UTSW 1 45321574 missense unknown
R8177:Col3a1 UTSW 1 45335764 missense unknown
R8183:Col3a1 UTSW 1 45334810 missense unknown
R8445:Col3a1 UTSW 1 45341180 nonsense probably null
R8490:Col3a1 UTSW 1 45345956 missense probably benign 0.01
R8546:Col3a1 UTSW 1 45340939 intron probably benign
R8720:Col3a1 UTSW 1 45347733 missense unknown
R8733:Col3a1 UTSW 1 45340312 splice site probably benign
R8888:Col3a1 UTSW 1 45339979 missense unknown
R9227:Col3a1 UTSW 1 45343978 missense unknown
R9230:Col3a1 UTSW 1 45343978 missense unknown
R9302:Col3a1 UTSW 1 45311820 nonsense probably null
R9366:Col3a1 UTSW 1 45341231 missense unknown
Z1177:Col3a1 UTSW 1 45311800 missense unknown
Predicted Primers PCR Primer
(F):5'- GGGTTAATAAAATCCAGAAGGCCCCAG -3'
(R):5'- CAGACATGGCTTGCATTTCTTTCAGAC -3'

Sequencing Primer
(F):5'- GGGTAAAACTGTTCATTTCCAGC -3'
(R):5'- CTTTCAGACCTCTATGCAGTAGAGAC -3'
Posted On 2014-03-14