Incidental Mutation 'R1482:Nup214'
ID 164423
Institutional Source Beutler Lab
Gene Symbol Nup214
Ensembl Gene ENSMUSG00000001855
Gene Name nucleoporin 214
Synonyms CAN, D2H9S46E
MMRRC Submission 039535-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1482 (G1)
Quality Score 167
Status Not validated
Chromosome 2
Chromosomal Location 31864446-31943204 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 31924478 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Phenylalanine at position 1669 (S1669F)
Ref Sequence ENSEMBL: ENSMUSP00000066492 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065398] [ENSMUST00000138012]
AlphaFold Q80U93
Predicted Effect probably damaging
Transcript: ENSMUST00000065398
AA Change: S1669F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000066492
Gene: ENSMUSG00000001855
AA Change: S1669F

DomainStartEndE-ValueType
WD40 138 178 2.48e0 SMART
WD40 182 220 2.67e-1 SMART
low complexity region 428 441 N/A INTRINSIC
low complexity region 449 467 N/A INTRINSIC
low complexity region 474 493 N/A INTRINSIC
low complexity region 529 546 N/A INTRINSIC
low complexity region 620 640 N/A INTRINSIC
low complexity region 645 656 N/A INTRINSIC
coiled coil region 853 881 N/A INTRINSIC
internal_repeat_1 969 993 1.13e-9 PROSPERO
internal_repeat_1 985 1009 1.13e-9 PROSPERO
low complexity region 1011 1026 N/A INTRINSIC
low complexity region 1049 1064 N/A INTRINSIC
low complexity region 1093 1111 N/A INTRINSIC
low complexity region 1201 1215 N/A INTRINSIC
low complexity region 1226 1248 N/A INTRINSIC
low complexity region 1279 1296 N/A INTRINSIC
low complexity region 1300 1311 N/A INTRINSIC
low complexity region 1391 1426 N/A INTRINSIC
low complexity region 1438 1454 N/A INTRINSIC
low complexity region 1458 1505 N/A INTRINSIC
low complexity region 1559 1573 N/A INTRINSIC
low complexity region 1611 1642 N/A INTRINSIC
low complexity region 1658 1670 N/A INTRINSIC
low complexity region 1686 1715 N/A INTRINSIC
low complexity region 1733 1748 N/A INTRINSIC
low complexity region 1771 1783 N/A INTRINSIC
low complexity region 1799 1832 N/A INTRINSIC
low complexity region 1853 1872 N/A INTRINSIC
low complexity region 1877 1886 N/A INTRINSIC
low complexity region 1898 1910 N/A INTRINSIC
low complexity region 1925 1934 N/A INTRINSIC
low complexity region 1969 1995 N/A INTRINSIC
low complexity region 2007 2032 N/A INTRINSIC
low complexity region 2048 2076 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123062
Predicted Effect possibly damaging
Transcript: ENSMUST00000138012
AA Change: S164F

PolyPhen 2 Score 0.919 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000115665
Gene: ENSMUSG00000001855
AA Change: S164F

DomainStartEndE-ValueType
low complexity region 54 68 N/A INTRINSIC
low complexity region 106 137 N/A INTRINSIC
low complexity region 153 165 N/A INTRINSIC
low complexity region 181 210 N/A INTRINSIC
low complexity region 228 243 N/A INTRINSIC
low complexity region 266 278 N/A INTRINSIC
low complexity region 294 327 N/A INTRINSIC
low complexity region 348 368 N/A INTRINSIC
low complexity region 373 382 N/A INTRINSIC
low complexity region 394 406 N/A INTRINSIC
low complexity region 421 430 N/A INTRINSIC
low complexity region 465 491 N/A INTRINSIC
low complexity region 503 528 N/A INTRINSIC
low complexity region 544 572 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 93.8%
  • 20x: 83.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The nuclear pore complex is a massive structure that extends across the nuclear envelope, forming a gateway that regulates the flow of macromolecules between the nucleus and the cytoplasm. Nucleoporins are the main components of the nuclear pore complex in eukaryotic cells. This gene is a member of the FG-repeat-containing nucleoporins. The protein encoded by this gene is localized to the cytoplasmic face of the nuclear pore complex where it is required for proper cell cycle progression and nucleocytoplasmic transport. The 3' portion of this gene forms a fusion gene with the DEK gene on chromosome 6 in a t(6,9) translocation associated with acute myeloid leukemia and myelodysplastic syndrome. Alternative splicing of this gene results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]
PHENOTYPE: Embryos homozygous for a null mutation die between 4.0 and 4.5 dpc, following depletion of maternally-derived gene product. In vitro, cultured 3.5-dpc mutant embryos arrest in the G2 phase, and show blastocoel contraction with defects in NLS-mediated protein import and polyadenylated RNA export. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810055G02Rik G A 19: 3,767,192 (GRCm39) D260N probably benign Het
Ankef1 A T 2: 136,392,078 (GRCm39) K422N possibly damaging Het
Anxa2 TCCC TCC 9: 69,397,036 (GRCm39) probably null Het
Aqp6 A T 15: 99,502,188 (GRCm39) *294C probably null Het
Baz2a T A 10: 127,944,877 (GRCm39) M38K possibly damaging Het
Bcl2l14 A G 6: 134,404,265 (GRCm39) D151G probably damaging Het
Cabp5 T A 7: 13,132,267 (GRCm39) L12* probably null Het
Cachd1 T C 4: 100,845,795 (GRCm39) V993A possibly damaging Het
Cd44 G A 2: 102,661,728 (GRCm39) T306I probably damaging Het
Cdc20 A T 4: 118,294,253 (GRCm39) N22K probably benign Het
Cdc6 T A 11: 98,807,807 (GRCm39) D433E possibly damaging Het
Clhc1 A G 11: 29,503,725 (GRCm39) D47G probably damaging Het
Csf2 T C 11: 54,139,389 (GRCm39) K65E probably benign Het
Cul9 T C 17: 46,819,473 (GRCm39) E2005G probably damaging Het
Dclk3 G T 9: 111,296,888 (GRCm39) R144L possibly damaging Het
Dcpp2 C T 17: 24,119,516 (GRCm39) T110I probably damaging Het
Disp1 A T 1: 182,868,038 (GRCm39) F1461I possibly damaging Het
Dnah1 C T 14: 31,016,831 (GRCm39) G1562D probably damaging Het
Ecpas T C 4: 58,820,163 (GRCm39) K1217E possibly damaging Het
Exoc3l2 C A 7: 19,229,284 (GRCm39) P234Q probably damaging Het
F2rl2 T C 13: 95,838,047 (GRCm39) V364A probably benign Het
Fam151a T C 4: 106,602,876 (GRCm39) L265P probably damaging Het
Fam151b T A 13: 92,586,674 (GRCm39) Q253L probably benign Het
Fat1 G A 8: 45,406,281 (GRCm39) V1011M probably benign Het
Fbxo6 G A 4: 148,230,441 (GRCm39) R274* probably null Het
Fgd4 G T 16: 16,302,337 (GRCm39) Q73K probably benign Het
Fth1 A G 19: 9,962,217 (GRCm39) T154A probably benign Het
Hgs C A 11: 120,370,866 (GRCm39) H572Q probably benign Het
Kcnk10 G A 12: 98,456,207 (GRCm39) T208I probably damaging Het
Kdm5b G A 1: 134,552,635 (GRCm39) V1204M probably damaging Het
Keg1 A C 19: 12,696,185 (GRCm39) H166P probably damaging Het
Kifap3 A T 1: 163,653,428 (GRCm39) N338I possibly damaging Het
Llcfc1 A T 6: 41,662,218 (GRCm39) D74V probably damaging Het
Lman2 A G 13: 55,499,218 (GRCm39) V219A possibly damaging Het
Mettl25 A G 10: 105,662,451 (GRCm39) I173T possibly damaging Het
Mov10 G T 3: 104,711,862 (GRCm39) P170Q probably damaging Het
Mtif2 G T 11: 29,486,847 (GRCm39) A286S probably damaging Het
Mtmr10 A G 7: 63,963,997 (GRCm39) Y244C probably damaging Het
Nbea A T 3: 55,987,414 (GRCm39) C359S probably damaging Het
Nbr1 C T 11: 101,463,667 (GRCm39) T633I probably benign Het
Nepn A T 10: 52,276,512 (GRCm39) T22S probably damaging Het
Oacyl T A 18: 65,871,043 (GRCm39) L342M probably damaging Het
Or2ag17 A G 7: 106,389,540 (GRCm39) F223L probably benign Het
Or52b2 T A 7: 104,986,463 (GRCm39) R153S probably damaging Het
Or6c205 T A 10: 129,087,012 (GRCm39) I203N possibly damaging Het
Or7e176 G A 9: 20,172,020 (GRCm39) V295I possibly damaging Het
Oxnad1 T C 14: 31,821,590 (GRCm39) probably null Het
Pard3b A T 1: 62,205,526 (GRCm39) D440V probably damaging Het
Pou3f2 T G 4: 22,486,960 (GRCm39) D391A possibly damaging Het
Ptprk T C 10: 28,139,512 (GRCm39) V79A probably benign Het
Rwdd2a A G 9: 86,456,331 (GRCm39) D169G probably damaging Het
Scn3b A C 9: 40,190,792 (GRCm39) D74A probably damaging Het
Setbp1 C T 18: 79,130,050 (GRCm39) D61N probably damaging Het
Setx T A 2: 29,053,004 (GRCm39) D2089E probably damaging Het
Vmn2r69 C G 7: 85,056,082 (GRCm39) W685C probably damaging Het
Vps8 A G 16: 21,400,348 (GRCm39) Q1272R probably benign Het
Wnk4 T C 11: 101,160,462 (GRCm39) F699L probably damaging Het
Zfp616 T A 11: 73,974,803 (GRCm39) N448K possibly damaging Het
Zfp618 C A 4: 63,033,685 (GRCm39) D307E possibly damaging Het
Zfp687 A G 3: 94,914,844 (GRCm39) F1219S probably damaging Het
Zfpm2 T A 15: 40,962,687 (GRCm39) D248E probably damaging Het
Other mutations in Nup214
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00490:Nup214 APN 2 31,923,991 (GRCm39) missense probably damaging 1.00
IGL00649:Nup214 APN 2 31,896,733 (GRCm39) missense probably benign 0.27
IGL01149:Nup214 APN 2 31,924,712 (GRCm39) missense probably damaging 1.00
IGL01360:Nup214 APN 2 31,928,190 (GRCm39) unclassified probably benign
IGL01409:Nup214 APN 2 31,916,943 (GRCm39) splice site probably null
IGL01530:Nup214 APN 2 31,923,733 (GRCm39) missense probably benign
IGL01554:Nup214 APN 2 31,941,084 (GRCm39) nonsense probably null
IGL01944:Nup214 APN 2 31,924,971 (GRCm39) nonsense probably null
IGL02296:Nup214 APN 2 31,878,200 (GRCm39) missense possibly damaging 0.65
IGL02563:Nup214 APN 2 31,867,872 (GRCm39) missense probably damaging 1.00
IGL02688:Nup214 APN 2 31,921,287 (GRCm39) missense probably benign
IGL02858:Nup214 APN 2 31,900,384 (GRCm39) splice site probably benign
IGL02953:Nup214 APN 2 31,878,241 (GRCm39) missense possibly damaging 0.87
IGL03090:Nup214 APN 2 31,908,254 (GRCm39) missense probably benign 0.01
IGL03124:Nup214 APN 2 31,886,452 (GRCm39) missense probably benign 0.27
IGL03225:Nup214 APN 2 31,924,423 (GRCm39) missense probably damaging 1.00
IGL03375:Nup214 APN 2 31,900,233 (GRCm39) missense probably damaging 0.97
Des_moines UTSW 2 31,870,596 (GRCm39) splice site probably null
ANU74:Nup214 UTSW 2 31,924,978 (GRCm39) missense probably damaging 0.99
R0035:Nup214 UTSW 2 31,880,379 (GRCm39) splice site probably null
R0243:Nup214 UTSW 2 31,888,069 (GRCm39) splice site probably benign
R0270:Nup214 UTSW 2 31,924,826 (GRCm39) missense probably damaging 0.96
R0358:Nup214 UTSW 2 31,894,312 (GRCm39) splice site probably null
R1168:Nup214 UTSW 2 31,915,313 (GRCm39) missense probably benign
R1242:Nup214 UTSW 2 31,867,782 (GRCm39) missense probably benign 0.00
R1481:Nup214 UTSW 2 31,924,478 (GRCm39) missense probably damaging 1.00
R1579:Nup214 UTSW 2 31,924,478 (GRCm39) missense probably damaging 1.00
R1580:Nup214 UTSW 2 31,924,478 (GRCm39) missense probably damaging 1.00
R1581:Nup214 UTSW 2 31,924,478 (GRCm39) missense probably damaging 1.00
R1610:Nup214 UTSW 2 31,924,478 (GRCm39) missense probably damaging 1.00
R1894:Nup214 UTSW 2 31,886,392 (GRCm39) missense possibly damaging 0.66
R2146:Nup214 UTSW 2 31,924,478 (GRCm39) missense probably damaging 1.00
R2149:Nup214 UTSW 2 31,924,478 (GRCm39) missense probably damaging 1.00
R2293:Nup214 UTSW 2 31,916,887 (GRCm39) missense probably benign
R2924:Nup214 UTSW 2 31,888,015 (GRCm39) missense probably damaging 1.00
R2925:Nup214 UTSW 2 31,888,015 (GRCm39) missense probably damaging 1.00
R3037:Nup214 UTSW 2 31,866,632 (GRCm39) missense probably benign 0.00
R3426:Nup214 UTSW 2 31,923,415 (GRCm39) missense probably damaging 0.97
R3799:Nup214 UTSW 2 31,924,694 (GRCm39) missense probably damaging 1.00
R3843:Nup214 UTSW 2 31,941,112 (GRCm39) missense probably damaging 1.00
R4323:Nup214 UTSW 2 31,884,696 (GRCm39) missense probably benign
R4353:Nup214 UTSW 2 31,867,929 (GRCm39) critical splice donor site probably null
R4601:Nup214 UTSW 2 31,887,977 (GRCm39) missense probably benign 0.36
R4626:Nup214 UTSW 2 31,923,416 (GRCm39) missense possibly damaging 0.92
R4874:Nup214 UTSW 2 31,870,596 (GRCm39) splice site probably null
R4938:Nup214 UTSW 2 31,873,171 (GRCm39) missense probably benign 0.00
R4939:Nup214 UTSW 2 31,873,171 (GRCm39) missense probably benign 0.00
R5027:Nup214 UTSW 2 31,881,329 (GRCm39) missense probably damaging 1.00
R5358:Nup214 UTSW 2 31,907,158 (GRCm39) missense unknown
R5406:Nup214 UTSW 2 31,892,619 (GRCm39) missense probably damaging 0.96
R5507:Nup214 UTSW 2 31,878,188 (GRCm39) missense possibly damaging 0.87
R5695:Nup214 UTSW 2 31,924,385 (GRCm39) missense probably damaging 1.00
R5744:Nup214 UTSW 2 31,900,308 (GRCm39) missense probably damaging 0.97
R5908:Nup214 UTSW 2 31,881,353 (GRCm39) missense probably benign 0.03
R5967:Nup214 UTSW 2 31,869,790 (GRCm39) missense possibly damaging 0.52
R6140:Nup214 UTSW 2 31,941,808 (GRCm39) missense possibly damaging 0.92
R6243:Nup214 UTSW 2 31,892,944 (GRCm39) missense possibly damaging 0.81
R6488:Nup214 UTSW 2 31,881,384 (GRCm39) missense possibly damaging 0.93
R6934:Nup214 UTSW 2 31,872,683 (GRCm39) nonsense probably null
R6970:Nup214 UTSW 2 31,941,810 (GRCm39) missense probably damaging 1.00
R7028:Nup214 UTSW 2 31,924,168 (GRCm39) missense probably benign 0.22
R7114:Nup214 UTSW 2 31,915,256 (GRCm39) missense possibly damaging 0.83
R7120:Nup214 UTSW 2 31,941,054 (GRCm39) missense probably benign 0.07
R7249:Nup214 UTSW 2 31,878,245 (GRCm39) missense possibly damaging 0.92
R7821:Nup214 UTSW 2 31,916,917 (GRCm39) missense possibly damaging 0.83
R8026:Nup214 UTSW 2 31,923,362 (GRCm39) missense possibly damaging 0.55
R8264:Nup214 UTSW 2 31,884,738 (GRCm39) missense possibly damaging 0.79
R8284:Nup214 UTSW 2 31,886,458 (GRCm39) missense possibly damaging 0.83
R8356:Nup214 UTSW 2 31,929,372 (GRCm39) missense probably benign 0.05
R8397:Nup214 UTSW 2 31,880,266 (GRCm39) missense probably damaging 0.96
R8456:Nup214 UTSW 2 31,929,372 (GRCm39) missense probably benign 0.05
R8785:Nup214 UTSW 2 31,924,465 (GRCm39) missense probably damaging 0.97
R9257:Nup214 UTSW 2 31,923,347 (GRCm39) missense possibly damaging 0.92
R9291:Nup214 UTSW 2 31,867,806 (GRCm39) missense probably benign 0.00
R9376:Nup214 UTSW 2 31,924,244 (GRCm39) missense probably benign 0.00
R9408:Nup214 UTSW 2 31,937,523 (GRCm39) missense probably damaging 1.00
R9613:Nup214 UTSW 2 31,901,035 (GRCm39) missense possibly damaging 0.90
R9789:Nup214 UTSW 2 31,907,227 (GRCm39) missense possibly damaging 0.46
RF015:Nup214 UTSW 2 31,924,718 (GRCm39) missense probably benign 0.00
X0026:Nup214 UTSW 2 31,910,318 (GRCm39) missense possibly damaging 0.46
X0065:Nup214 UTSW 2 31,932,488 (GRCm39) missense probably damaging 1.00
Z1088:Nup214 UTSW 2 31,901,235 (GRCm39) missense probably benign 0.27
Z1176:Nup214 UTSW 2 31,924,237 (GRCm39) nonsense probably null
Z1176:Nup214 UTSW 2 31,900,270 (GRCm39) missense possibly damaging 0.66
Z1177:Nup214 UTSW 2 31,887,971 (GRCm39) missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- GCATCTCTGCAAACTTCTGACCCTG -3'
(R):5'- AATGCTGTCTGTCCGAACACTCC -3'

Sequencing Primer
(F):5'- AGAACCTGTTCTTGTGCAGAC -3'
(R):5'- CTCCAGGAGCTGAAGCAC -3'
Posted On 2014-03-28