Mutagenetix > Incidental Mutation

Incidental Mutation 'R1517:Rttn'

167147

Institutional Source

Beutler Lab

Gene Symbol

Rttn

Ensembl Gene

ENSMUSG00000023066

Gene Name

rotatin

Synonyms

C530033I08Rik, 4921538A15Rik

MMRRC Submission

039563-MU

Accession Numbers

Ncbi RefSeq: NM_175542.3; MGI:2179288

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1517 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

88971790-89131013 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 89113350 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 1951 (V1951A)

Ref Sequence

ENSEMBL: ENSMUSP00000023828 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023828]

AlphaFold

Q8R4Y8

Predicted Effect

probably benign
Transcript: ENSMUST00000023828
AA Change: V1951A

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000023828
Gene: ENSMUSG00000023066
AA Change: V1951A

Domain	Start	End	E-Value	Type
Pfam:RTTN_N	16	112	1.2e-36	PFAM
low complexity region	188	199	N/A	INTRINSIC
Blast:ARM	216	261	9e-18	BLAST
low complexity region	302	319	N/A	INTRINSIC
low complexity region	335	341	N/A	INTRINSIC
SCOP:d1gw5a_	515	952	9e-3	SMART
Blast:ARM	863	910	4e-8	BLAST
low complexity region	972	985	N/A	INTRINSIC
low complexity region	1165	1176	N/A	INTRINSIC
low complexity region	1213	1222	N/A	INTRINSIC
low complexity region	1680	1698	N/A	INTRINSIC
low complexity region	1861	1879	N/A	INTRINSIC
Blast:ARM	2088	2129	1e-10	BLAST

Meta Mutation Damage Score

0.0586

Coding Region Coverage

1x: 99.1%
3x: 98.2%
10x: 95.9%
20x: 91.9%

Validation Efficiency

100% (67/67)

MGI Phenotype

Strain: 2674124
Lethality: E9-E12
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large protein whose specific function is unknown. Absence of the orthologous protein in mouse results in embryonic lethality with deficient axial rotation, abnormal differentiation of the neural tube, and randomized looping of the heart tube during development. In human, mutations in this gene are associated with polymicrogyria with seizures. In human fibroblasts this protein localizes at the ciliary basal bodies. Given the intracellular localization of this protein and the phenotypic effects of mutations, this gene is suspected of playing a role in the maintenance of normal ciliary structure which in turn effects the developmental process of left-right organ specification, axial rotation, and perhaps notochord development. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for an insertional mutation exhibit embryonic lethality and neurulation defects resulting in the arrest of gastrulation movements and abnormal left-right specification in the heart. [provided by MGI curators]

Allele List at MGI

All alleles(15) : Targeted(2) Gene trapped(12) Transgenic(1)

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca8b	T	C	11: 109,971,814	K375R	possibly damaging	Het
Adrb2	T	C	18: 62,178,800	N318S	probably damaging	Het
Akap5	A	C	12: 76,329,262	E489D	possibly damaging	Het
Aldh7a1	T	A	18: 56,532,061	I385F	probably damaging	Het
Astn1	T	A	1: 158,579,576		probably benign	Het
Atp7b	T	A	8: 21,997,358	T1314S	probably damaging	Het
Bhmt2	C	A	13: 93,662,339	G325C	probably damaging	Het
Brpf1	T	A	6: 113,319,089	V781E	probably benign	Het
Cacna1c	T	A	6: 118,598,759	Y1860F	probably benign	Het
Ccdc7a	T	C	8: 129,061,681	T56A	probably damaging	Het
Cep78	A	G	19: 15,959,663	S560P	probably damaging	Het
Cnot1	G	A	8: 95,743,213	T1343I	probably benign	Het
Coq10b	T	C	1: 55,064,257	S65P	probably damaging	Het
Creld1	T	A	6: 113,489,784	C243S	probably damaging	Het
Cst12	A	T	2: 148,793,252	I121F	possibly damaging	Het
Cyp26a1	A	C	19: 37,698,860	E165A	probably benign	Het
Cyp2d12	T	G	15: 82,558,136	M273R	probably damaging	Het
Dnajb7	T	A	15: 81,407,456	S227C	probably damaging	Het
Evc	T	A	5: 37,319,035	Q390L	probably damaging	Het
F830016B08Rik	T	A	18: 60,300,898	L351*	probably null	Het
Fga	T	C	3: 83,031,838	S507P	probably benign	Het
Gba	A	T	3: 89,206,148	Y239F	probably damaging	Het
Golga2	C	A	2: 32,305,984	Y843*	probably null	Het
Gria4	C	A	9: 4,793,865	L64F	probably damaging	Het
Hectd3	A	G	4: 117,002,994	Y803C	probably damaging	Het
Hmcn1	T	C	1: 150,669,421	K2812E	probably damaging	Het
Il17b	T	G	18: 61,690,245	V50G	probably damaging	Het
Itga2b	A	T	11: 102,466,325	L243*	probably null	Het
Kank4	C	A	4: 98,779,029	V394L	possibly damaging	Het
Kat14	T	A	2: 144,373,791	D65E	probably benign	Het
Kcnh3	T	C	15: 99,238,209	Y696H	probably damaging	Het
Kctd19	C	A	8: 105,395,376	D180Y	probably damaging	Het
Klra8	A	C	6: 130,115,640	S233A	probably benign	Het
Masp2	A	T	4: 148,612,106	T387S	possibly damaging	Het
Midn	C	A	10: 80,154,123	T275N	probably damaging	Het
Mis18bp1	A	G	12: 65,133,813	F965L	probably benign	Het
Myo3a	G	T	2: 22,282,634	V186L	probably damaging	Het
Ncoa2	T	A	1: 13,165,057	N884I	probably benign	Het
Olfr1082	T	A	2: 86,594,604	T75S	probably damaging	Het
Olfr272	A	T	4: 52,911,502	C97*	probably null	Het
Olfr963	T	C	9: 39,669,720	I221T	probably damaging	Het
Osr2	T	C	15: 35,300,667	V123A	probably benign	Het
P4ha2	A	G	11: 54,117,645	H226R	probably benign	Het
Pcdhb16	T	A	18: 37,478,098	V37E	probably benign	Het
Pcdhb18	T	A	18: 37,489,620	M1K	probably null	Het
Pcsk1	T	A	13: 75,098,047	Y181*	probably null	Het
Pros1	G	T	16: 62,885,512	C63F	probably damaging	Het
Ranbp3l	T	A	15: 9,065,001	C353*	probably null	Het
Rev3l	T	C	10: 39,838,443	Y2388H	probably benign	Het
Rif1	GCCACCA	GCCA	2: 52,110,324		probably benign	Het
Rpl12-ps1	G	T	1: 36,958,377		noncoding transcript	Het
Scn9a	G	A	2: 66,505,027		probably benign	Het
Sdk1	T	C	5: 142,127,836	F1546S	probably damaging	Het
Sh3glb2	C	T	2: 30,354,975	R71Q	probably damaging	Het
Slc30a6	T	C	17: 74,408,847	F101L	probably benign	Het
Snrpd1	T	C	18: 10,626,913	I60T	probably damaging	Het
Sox10	T	A	15: 79,159,178	E218D	probably benign	Het
Tekt3	C	A	11: 63,070,490	H162N	probably damaging	Het
Tnfsf13	T	C	11: 69,684,738	S246G	possibly damaging	Het
Trim10	T	A	17: 36,872,454	I214N	probably damaging	Het
Trp63	C	A	16: 25,889,253	D566E	probably damaging	Het
Uck2	T	C	1: 167,234,724	D156G	probably damaging	Het
Zfp386	T	A	12: 116,059,605	S314R	possibly damaging	Het
Zfp467	C	T	6: 48,438,236	R494H	probably damaging	Het
Zfp735	A	T	11: 73,710,644	D138V	probably benign	Het
Zfyve26	T	C	12: 79,252,151	E445G	probably damaging	Het

Other mutations in Rttn

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00595:Rttn	APN	18	88974340	missense	probably benign	0.00
IGL00788:Rttn	APN	18	88972509	missense	probably benign	0.00
IGL00929:Rttn	APN	18	89028935	missense	probably damaging	1.00
IGL01392:Rttn	APN	18	88995613	missense	probably benign	0.03
IGL01395:Rttn	APN	18	89129770	missense	possibly damaging	0.89
IGL01701:Rttn	APN	18	89064215	missense	probably damaging	1.00
IGL02136:Rttn	APN	18	89046128	missense	possibly damaging	0.87
IGL02151:Rttn	APN	18	89020205	missense	probably damaging	1.00
IGL02165:Rttn	APN	18	89043041	missense	probably benign
IGL02228:Rttn	APN	18	89042231	missense	probably damaging	1.00
IGL02276:Rttn	APN	18	89048454	missense	possibly damaging	0.94
IGL02612:Rttn	APN	18	88973626	missense	probably damaging	1.00
IGL02645:Rttn	APN	18	89110686	missense	probably benign	0.04
IGL02716:Rttn	APN	18	89048417	missense	possibly damaging	0.77
IGL02820:Rttn	APN	18	89028998	missense	probably damaging	1.00
IGL02961:Rttn	APN	18	89053573	missense	probably damaging	1.00
IGL02973:Rttn	APN	18	88972494	missense	probably damaging	1.00
IGL03027:Rttn	APN	18	88979690	missense	probably damaging	1.00
IGL03082:Rttn	APN	18	88983948	missense	probably damaging	1.00
IGL03121:Rttn	APN	18	88975751	missense	probably damaging	1.00
IGL03135:Rttn	APN	18	89015150	missense	probably damaging	1.00
IGL03328:Rttn	APN	18	89043028	missense	probably benign	0.19
Fascisti	UTSW	18	89009460	splice site	probably benign
marcher	UTSW	18	89037946	missense	probably damaging	0.99
militaristi	UTSW	18	89010916	missense	probably damaging	1.00
Thoughtless	UTSW	18	89014611	missense	probably damaging	1.00
twister	UTSW	18	89046162	critical splice donor site	probably null
Vermiculus	UTSW	18	89090433	missense	probably benign
R0062:Rttn	UTSW	18	89010966	critical splice donor site	probably null
R0062:Rttn	UTSW	18	89010966	critical splice donor site	probably null
R0310:Rttn	UTSW	18	89009460	splice site	probably benign
R0330:Rttn	UTSW	18	88986080	splice site	probably null
R0363:Rttn	UTSW	18	89010955	missense	probably damaging	1.00
R0485:Rttn	UTSW	18	89090419	splice site	probably benign
R0590:Rttn	UTSW	18	88979635	missense	probably damaging	1.00
R0601:Rttn	UTSW	18	89042966	missense	probably benign	0.00
R0604:Rttn	UTSW	18	88977758	missense	probably damaging	1.00
R0631:Rttn	UTSW	18	88989546	missense	probably benign	0.00
R0882:Rttn	UTSW	18	88973689	nonsense	probably null
R0885:Rttn	UTSW	18	88983810	missense	probably benign	0.03
R0900:Rttn	UTSW	18	89101691	missense	probably benign	0.13
R1077:Rttn	UTSW	18	89064249	missense	probably damaging	1.00
R1444:Rttn	UTSW	18	89042867	missense	probably benign	0.04
R1460:Rttn	UTSW	18	89109357	splice site	probably benign
R1630:Rttn	UTSW	18	89042954	missense	probably benign	0.02
R1632:Rttn	UTSW	18	89009336	missense	probably benign	0.18
R1722:Rttn	UTSW	18	88973531	missense	probably benign	0.34
R1755:Rttn	UTSW	18	89009317	missense	probably damaging	1.00
R1881:Rttn	UTSW	18	89015212	missense	probably damaging	0.96
R1971:Rttn	UTSW	18	89090433	missense	probably benign
R2035:Rttn	UTSW	18	89020216	missense	probably damaging	1.00
R2109:Rttn	UTSW	18	88986073	missense	possibly damaging	0.93
R2191:Rttn	UTSW	18	89095648	critical splice donor site	probably null
R2201:Rttn	UTSW	18	89010943	missense	possibly damaging	0.88
R2266:Rttn	UTSW	18	89064171	missense	probably benign	0.05
R3014:Rttn	UTSW	18	89014620	missense	probably damaging	1.00
R3052:Rttn	UTSW	18	89015246	splice site	probably benign
R3427:Rttn	UTSW	18	89095651	splice site	probably null
R3431:Rttn	UTSW	18	89095571	missense	probably benign	0.04
R3786:Rttn	UTSW	18	89037894	missense	probably benign	0.00
R3803:Rttn	UTSW	18	88977707	missense	probably damaging	0.96
R3980:Rttn	UTSW	18	89017275	missense	probably benign	0.12
R4035:Rttn	UTSW	18	88995653	missense	probably benign	0.03
R4170:Rttn	UTSW	18	88975723	missense	probably damaging	1.00
R4223:Rttn	UTSW	18	89095584	missense	probably damaging	1.00
R4273:Rttn	UTSW	18	89091896	missense	probably benign
R4517:Rttn	UTSW	18	89028973	missense	probably damaging	0.99
R4674:Rttn	UTSW	18	89011011	splice site	probably null
R4837:Rttn	UTSW	18	89090415	splice site	probably null
R4869:Rttn	UTSW	18	89043014	nonsense	probably null
R4881:Rttn	UTSW	18	89101685	missense	probably damaging	1.00
R4959:Rttn	UTSW	18	89042168	missense	probably damaging	1.00
R4973:Rttn	UTSW	18	89042168	missense	probably damaging	1.00
R4975:Rttn	UTSW	18	89064085	splice site	probably null
R5166:Rttn	UTSW	18	89013094	missense	possibly damaging	0.48
R5243:Rttn	UTSW	18	89108063	missense	possibly damaging	0.74
R5594:Rttn	UTSW	18	89090436	missense	possibly damaging	0.95
R5654:Rttn	UTSW	18	89048432	missense	probably benign
R5794:Rttn	UTSW	18	88995569	missense	probably benign	0.18
R5799:Rttn	UTSW	18	89037946	missense	probably damaging	0.99
R5955:Rttn	UTSW	18	89121009	missense	probably damaging	0.99
R5963:Rttn	UTSW	18	89073695	missense	probably benign	0.01
R5989:Rttn	UTSW	18	88973626	missense	probably damaging	1.00
R6004:Rttn	UTSW	18	89021692	missense	probably damaging	0.96
R6132:Rttn	UTSW	18	89115646	critical splice donor site	probably null
R6430:Rttn	UTSW	18	89021685	missense	probably null	0.18
R6436:Rttn	UTSW	18	89110729	missense	probably damaging	1.00
R6681:Rttn	UTSW	18	89014611	missense	probably damaging	1.00
R6994:Rttn	UTSW	18	89028899	missense	probably damaging	1.00
R7049:Rttn	UTSW	18	89064216	missense	probably damaging	1.00
R7078:Rttn	UTSW	18	89009422	missense	probably benign	0.03
R7083:Rttn	UTSW	18	89090598	missense	probably damaging	1.00
R7250:Rttn	UTSW	18	88989523	missense	probably benign	0.03
R7402:Rttn	UTSW	18	88985911	missense	possibly damaging	0.92
R7565:Rttn	UTSW	18	89060479	missense	probably damaging	1.00
R7588:Rttn	UTSW	18	89064229	missense	probably damaging	0.97
R8029:Rttn	UTSW	18	89090474	missense	not run
R8085:Rttn	UTSW	18	89053548	nonsense	probably null
R8113:Rttn	UTSW	18	89010916	missense	probably damaging	1.00
R8355:Rttn	UTSW	18	89028892	missense	probably benign	0.05
R8531:Rttn	UTSW	18	89113343	missense	probably benign	0.00
R8992:Rttn	UTSW	18	88977708	missense	probably benign	0.24
R9008:Rttn	UTSW	18	89009432	missense	probably damaging	1.00
R9139:Rttn	UTSW	18	89020137	missense	probably benign	0.30
R9210:Rttn	UTSW	18	89046162	critical splice donor site	probably null
R9212:Rttn	UTSW	18	89046162	critical splice donor site	probably null
R9286:Rttn	UTSW	18	88977725	missense	probably benign	0.06
R9368:Rttn	UTSW	18	89060452	missense	probably damaging	1.00
R9632:Rttn	UTSW	18	89017210	missense	possibly damaging	0.82
R9710:Rttn	UTSW	18	89017210	missense	possibly damaging	0.82
X0017:Rttn	UTSW	18	89113402	missense	probably benign	0.01
X0022:Rttn	UTSW	18	88973667	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TGCCCAACATGAAGCACCAGTG -3'
(R):5'- CCTCTGAATGCAGTTTCCCACAACC -3'

Sequencing Primer
(F):5'- CCAGTGAACTGAGAAGTTCTTCC -3'
(R):5'- ATGGTCTGTAGCTTTAAGACCC -3'

Posted On

2014-04-13