Incidental Mutation 'R1514:Eprs'
ID168597
Institutional Source Beutler Lab
Gene Symbol Eprs
Ensembl Gene ENSMUSG00000026615
Gene Nameglutamyl-prolyl-tRNA synthetase
Synonyms2410081F06Rik, 3010002K18Rik, Qprs
MMRRC Submission 039561-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1514 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location185363044-185428360 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 185381834 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 326 (M326I)
Ref Sequence ENSEMBL: ENSMUSP00000045841 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046514] [ENSMUST00000191900] [ENSMUST00000195824]
Predicted Effect probably damaging
Transcript: ENSMUST00000046514
AA Change: M326I

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000045841
Gene: ENSMUSG00000026615
AA Change: M326I

DomainStartEndE-ValueType
Pfam:GST_C_3 71 156 2.1e-15 PFAM
Pfam:GST_C 72 157 2.9e-7 PFAM
Pfam:tRNA-synt_1c 197 502 8.8e-127 PFAM
Pfam:tRNA-synt_1c_C 504 681 4.4e-42 PFAM
WHEP-TRS 753 815 1.26e-25 SMART
WHEP-TRS 826 888 1.47e-26 SMART
WHEP-TRS 904 966 3.76e-24 SMART
low complexity region 984 1011 N/A INTRINSIC
Pfam:tRNA-synt_2b 1107 1287 3.1e-17 PFAM
Pfam:HGTP_anticodon 1303 1404 1.7e-19 PFAM
ProRS-C_1 1430 1512 5.27e-28 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000191900
SMART Domains Protein: ENSMUSP00000141467
Gene: ENSMUSG00000026615

DomainStartEndE-ValueType
Pfam:GST_C 66 131 1.7e-4 PFAM
Pfam:GST_C_3 70 131 8.9e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192284
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193788
Predicted Effect probably benign
Transcript: ENSMUST00000195824
SMART Domains Protein: ENSMUSP00000141550
Gene: ENSMUSG00000026615

DomainStartEndE-ValueType
Pfam:GST_C 33 96 8.4e-5 PFAM
Pfam:GST_C_3 35 96 3.9e-11 PFAM
Meta Mutation Damage Score 0.5830 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Aminoacyl-tRNA synthetases are a class of enzymes that charge tRNAs with their cognate amino acids. The protein encoded by this gene is a multifunctional aminoacyl-tRNA synthetase that catalyzes the aminoacylation of glutamic acid and proline tRNA species. Alternative splicing has been observed for this gene, but the full-length nature and biological validity of the variant have not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a phospho-mimetic allele exhibit normal body weight, life span and glucose metabolism. Mice homozygous for a phospho-deficient allele exhibit decrease body weight, enhanced lipolysis, altered glucose metabolism and increased energy expenditure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik T A 10: 100,612,867 L147Q probably damaging Het
Abcb1a A G 5: 8,674,791 T75A possibly damaging Het
Acvr1 A T 2: 58,447,585 L495* probably null Het
Add1 T C 5: 34,610,617 I240T probably benign Het
Adgra2 C A 8: 27,121,278 S870* probably null Het
Amer3 G A 1: 34,579,327 probably benign Het
Baz2b A T 2: 59,962,326 V486D probably benign Het
Bcorl1 T A X: 48,405,944 D1697E probably damaging Het
Cenpf T C 1: 189,679,141 D282G possibly damaging Het
Cep112 A G 11: 108,472,054 D200G probably damaging Het
Clec4a4 C T 6: 122,990,442 P26S probably benign Het
Crygf A C 1: 65,928,038 R102S possibly damaging Het
Cyp2b19 A T 7: 26,767,160 E404D probably benign Het
Dcdc2a A G 13: 25,061,254 I105V probably benign Het
Dus4l T C 12: 31,640,939 M238V probably damaging Het
Evpl T C 11: 116,223,835 T1010A probably benign Het
Fam124b T C 1: 80,200,431 T284A possibly damaging Het
Fam84a C T 12: 14,149,863 V288M probably damaging Het
Glb1l2 A G 9: 26,769,124 probably benign Het
Gm15922 G A 7: 3,739,640 T23I possibly damaging Het
Gm16223 T A 5: 42,067,955 probably null Het
Gm438 T C 4: 144,777,759 N274S probably damaging Het
Gm4952 T A 19: 12,626,914 M230K probably damaging Het
Gm5828 C A 1: 16,769,359 noncoding transcript Het
Gm597 T A 1: 28,778,748 T68S possibly damaging Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Ifna16 T A 4: 88,676,742 T39S possibly damaging Het
Kcnc3 G A 7: 44,595,603 G439D probably damaging Het
Kif1c T C 11: 70,705,729 S257P probably damaging Het
Kng1 A G 16: 23,079,760 K456E probably damaging Het
Lpxn T C 19: 12,824,050 L142P probably damaging Het
Med23 A G 10: 24,892,667 probably benign Het
Mgea5 A G 19: 45,776,931 S146P probably damaging Het
Mks1 A T 11: 87,861,111 D369V probably benign Het
Myo1d A T 11: 80,685,908 Y114N probably damaging Het
Npas2 A G 1: 39,311,854 D126G possibly damaging Het
Olfr1314 T C 2: 112,092,036 I222V probably benign Het
Olfr1420 A G 19: 11,896,614 T198A probably benign Het
Olfr148 T C 9: 39,613,696 I43T probably damaging Het
Onecut2 T C 18: 64,341,580 F401L possibly damaging Het
Parp11 T A 6: 127,474,293 F102Y possibly damaging Het
Pcnx C T 12: 81,918,798 H580Y probably damaging Het
Pde3b A G 7: 114,530,766 H852R probably damaging Het
Pou2af1 A G 9: 51,233,208 T141A probably benign Het
Rgs22 A C 15: 36,013,100 V1190G probably benign Het
Rnf112 T C 11: 61,450,410 S450G probably benign Het
Rpgrip1l A T 8: 91,260,750 I893N probably damaging Het
Rps3a1 A G 3: 86,138,527 V210A probably benign Het
Runx2 C T 17: 44,735,337 A114T possibly damaging Het
Sardh A G 2: 27,197,690 V723A possibly damaging Het
Sdk2 C T 11: 113,838,646 silent Het
Secisbp2 A G 13: 51,682,095 S742G possibly damaging Het
Selenow G T 7: 15,920,298 probably benign Het
Slc30a4 A G 2: 122,689,414 V226A probably damaging Het
Sntb2 A G 8: 106,991,532 N291D probably damaging Het
Sorbs2 A G 8: 45,769,829 T190A probably damaging Het
Specc1 T A 11: 62,156,532 L909H probably damaging Het
Sprr1b T C 3: 92,437,107 *154W probably null Het
Taar4 T A 10: 23,960,612 M40K possibly damaging Het
Ubr2 A T 17: 47,000,823 L34H probably damaging Het
Ubxn6 T C 17: 56,069,003 K386R probably benign Het
Vmn2r112 A T 17: 22,602,844 T168S probably benign Het
Xirp2 A T 2: 67,514,323 R2303* probably null Het
Zbtb14 C A 17: 69,388,502 F398L probably damaging Het
Zfp13 G T 17: 23,576,412 T395K probably damaging Het
Zfp281 A G 1: 136,626,697 N471S probably benign Het
Other mutations in Eprs
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00528:Eprs APN 1 185407148 missense probably benign 0.11
IGL00532:Eprs APN 1 185407148 missense probably benign 0.11
IGL00543:Eprs APN 1 185407148 missense probably benign 0.11
IGL00553:Eprs APN 1 185407148 missense probably benign 0.11
IGL00574:Eprs APN 1 185407148 missense probably benign 0.11
IGL00583:Eprs APN 1 185407148 missense probably benign 0.11
IGL00946:Eprs APN 1 185407701 missense probably benign 0.02
IGL01062:Eprs APN 1 185379615 missense probably benign 0.19
IGL01477:Eprs APN 1 185411375 splice site probably benign
IGL01608:Eprs APN 1 185385114 unclassified probably benign
IGL01767:Eprs APN 1 185384915 missense probably damaging 0.98
IGL02136:Eprs APN 1 185384983 missense probably damaging 1.00
IGL02302:Eprs APN 1 185387124 splice site probably benign
IGL02528:Eprs APN 1 185413489 missense probably damaging 1.00
IGL02631:Eprs APN 1 185427898 missense probably damaging 1.00
IGL02989:Eprs APN 1 185418366 missense probably benign 0.31
IGL03004:Eprs APN 1 185381833 missense probably damaging 1.00
R0003:Eprs UTSW 1 185414391 missense probably damaging 1.00
R0003:Eprs UTSW 1 185414391 missense probably damaging 1.00
R0179:Eprs UTSW 1 185413547 missense probably benign
R0783:Eprs UTSW 1 185398458 missense probably damaging 1.00
R1319:Eprs UTSW 1 185384962 missense probably damaging 1.00
R1335:Eprs UTSW 1 185387089 missense probably damaging 1.00
R1590:Eprs UTSW 1 185401510 missense probably damaging 1.00
R1688:Eprs UTSW 1 185384896 missense probably damaging 0.99
R1725:Eprs UTSW 1 185406992 missense probably damaging 1.00
R2182:Eprs UTSW 1 185379742 splice site probably null
R2228:Eprs UTSW 1 185367537 missense probably damaging 1.00
R2336:Eprs UTSW 1 185411374 splice site probably benign
R2338:Eprs UTSW 1 185415808 missense probably damaging 1.00
R2439:Eprs UTSW 1 185379742 splice site probably null
R2914:Eprs UTSW 1 185379742 splice site probably null
R3001:Eprs UTSW 1 185424391 critical splice donor site probably null
R3002:Eprs UTSW 1 185424391 critical splice donor site probably null
R3003:Eprs UTSW 1 185424391 critical splice donor site probably null
R3547:Eprs UTSW 1 185379742 splice site probably null
R3775:Eprs UTSW 1 185373008 missense probably damaging 1.00
R3878:Eprs UTSW 1 185415953 critical splice donor site probably null
R3902:Eprs UTSW 1 185379742 splice site probably null
R3913:Eprs UTSW 1 185379742 splice site probably null
R4579:Eprs UTSW 1 185401607 missense probably damaging 1.00
R4664:Eprs UTSW 1 185373076 intron probably benign
R4680:Eprs UTSW 1 185386278 missense possibly damaging 0.87
R4712:Eprs UTSW 1 185428108 missense probably benign 0.00
R4749:Eprs UTSW 1 185396130 missense probably damaging 0.97
R4995:Eprs UTSW 1 185410139 intron probably benign
R5154:Eprs UTSW 1 185413465 missense probably damaging 1.00
R5640:Eprs UTSW 1 185374184 missense probably benign 0.34
R5662:Eprs UTSW 1 185394425 missense possibly damaging 0.72
R6037:Eprs UTSW 1 185396109 missense probably damaging 1.00
R6037:Eprs UTSW 1 185396109 missense probably damaging 1.00
R6151:Eprs UTSW 1 185407754 critical splice donor site probably null
R6387:Eprs UTSW 1 185387084 missense possibly damaging 0.94
R6647:Eprs UTSW 1 185414424 missense probably damaging 1.00
R6701:Eprs UTSW 1 185370890 missense probably damaging 0.99
R6997:Eprs UTSW 1 185396163 missense possibly damaging 0.50
R7295:Eprs UTSW 1 185418210 critical splice acceptor site probably null
R7305:Eprs UTSW 1 185379701 missense probably damaging 1.00
R7729:Eprs UTSW 1 185413169 missense probably damaging 1.00
R7732:Eprs UTSW 1 185372939 missense probably benign 0.01
R7733:Eprs UTSW 1 185397161 missense probably benign
R7826:Eprs UTSW 1 185406968 missense probably damaging 0.96
R7988:Eprs UTSW 1 185418348 missense probably damaging 1.00
R8071:Eprs UTSW 1 185394456 missense possibly damaging 0.67
R8157:Eprs UTSW 1 185398394 missense probably benign 0.21
R8209:Eprs UTSW 1 185407615 missense possibly damaging 0.71
R8370:Eprs UTSW 1 185399257 missense probably damaging 0.98
R8493:Eprs UTSW 1 185407174 nonsense probably null
R8556:Eprs UTSW 1 185420288 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AGCGTTTCACTGAGTAGCCCTTCC -3'
(R):5'- TCACCATGAAGAACGAGGCACTG -3'

Sequencing Primer
(F):5'- AGTAGCCCTTCCTGGCCTC -3'
(R):5'- ACATTCTCACACTGGGGC -3'
Posted On2014-04-13