Incidental Mutation 'R1500:Ubr2'
Institutional Source Beutler Lab
Gene Symbol Ubr2
Ensembl Gene ENSMUSG00000023977
Gene Nameubiquitin protein ligase E3 component n-recognin 2
Synonyms9930021A08Rik, E130209G04Rik, ENSMUSG00000043296
MMRRC Submission 039551-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.826) question?
Stock #R1500 (G1)
Quality Score225
Status Validated
Chromosomal Location46928295-47010556 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 46986689 bp
Amino Acid Change Threonine to Alanine at position 253 (T253A)
Ref Sequence ENSEMBL: ENSMUSP00000108963 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113335] [ENSMUST00000113337] [ENSMUST00000225599]
Predicted Effect possibly damaging
Transcript: ENSMUST00000113335
AA Change: T253A

PolyPhen 2 Score 0.790 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000108961
Gene: ENSMUSG00000023977
AA Change: T253A

ZnF_UBR1 97 167 3.14e-32 SMART
Pfam:ClpS 221 302 2.4e-23 PFAM
low complexity region 635 646 N/A INTRINSIC
low complexity region 749 760 N/A INTRINSIC
low complexity region 872 886 N/A INTRINSIC
coiled coil region 1019 1046 N/A INTRINSIC
RING 1108 1213 7.66e-1 SMART
low complexity region 1221 1235 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000113337
AA Change: T253A

PolyPhen 2 Score 0.790 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000108963
Gene: ENSMUSG00000023977
AA Change: T253A

ZnF_UBR1 97 167 3.14e-32 SMART
Pfam:ClpS 222 301 6.2e-26 PFAM
low complexity region 635 646 N/A INTRINSIC
low complexity region 749 760 N/A INTRINSIC
low complexity region 872 886 N/A INTRINSIC
coiled coil region 1019 1046 N/A INTRINSIC
RING 1108 1213 7.66e-1 SMART
low complexity region 1221 1235 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224759
Predicted Effect probably benign
Transcript: ENSMUST00000225599
Meta Mutation Damage Score 0.0739 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 94.7%
  • 20x: 87.1%
Validation Efficiency 95% (81/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an E3 ubiquitin ligase of the N-end rule proteolytic pathway that targets proteins with destabilizing N-terminal residues for polyubiquitylation and proteasome-mediated degradation. Alternative splicing results in multiple transcript variants.[provided by RefSeq, May 2010]
PHENOTYPE: On a mixed genetic background, female homozygotes for a targeted null mutation exhibit embryonic lethality, while males are viable, but sterile due to postnatal testicular degeneration. On an inbred background, both genders die in utero. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik C A 11: 78,284,132 Q1698K possibly damaging Het
Abcg1 A G 17: 31,111,279 D518G probably benign Het
Acaca T A 11: 84,293,984 D96E probably benign Het
Actbl2 G A 13: 111,255,320 R63Q probably damaging Het
Adamts6 T A 13: 104,312,881 H266Q probably damaging Het
Aff4 T C 11: 53,372,378 V75A probably benign Het
Ank2 A G 3: 126,932,982 S888P probably benign Het
Ano7 T C 1: 93,397,328 F534S probably damaging Het
Arhgef6 T C X: 57,338,562 M5V probably benign Het
Bcam T A 7: 19,758,964 D484V possibly damaging Het
Ccdc88a T C 11: 29,482,713 Y1240H probably benign Het
Cfh T C 1: 140,100,876 Y500C probably damaging Het
Chd1l G A 3: 97,582,805 A478V probably benign Het
Dnah1 T C 14: 31,316,758 D122G probably benign Het
Dnah11 A T 12: 118,012,829 probably null Het
Dnah17 T C 11: 118,101,053 K1230E probably benign Het
Dync1h1 G A 12: 110,636,509 E2195K probably benign Het
E330020D12Rik A T 1: 153,408,379 noncoding transcript Het
Ece2 T C 16: 20,644,242 L639P probably damaging Het
Epha3 A T 16: 63,595,662 V658E probably benign Het
Erbb2 C T 11: 98,428,978 T632I probably damaging Het
Erc2 A G 14: 28,271,660 T883A probably damaging Het
Extl2 T C 3: 116,027,140 V198A probably benign Het
Fktn G T 4: 53,735,065 M234I probably benign Het
Ggt7 A G 2: 155,499,046 S400P probably benign Het
Gldc A C 19: 30,113,825 V790G possibly damaging Het
Gm14496 A C 2: 181,991,233 Q3P probably benign Het
H2-D1 G A 17: 35,263,588 E95K probably benign Het
Ikzf3 T C 11: 98,518,695 E14G probably benign Het
Jag1 A T 2: 137,115,638 N51K possibly damaging Het
Khdrbs3 A G 15: 68,928,786 D14G possibly damaging Het
Krt84 A G 15: 101,530,224 V276A probably damaging Het
Lamb1 T C 12: 31,298,949 I660T possibly damaging Het
Lcmt2 A T 2: 121,140,007 S198R probably benign Het
Lcn6 G A 2: 25,677,119 R44H probably benign Het
Lrfn5 A T 12: 61,839,741 H105L probably damaging Het
Lrit1 G A 14: 37,062,134 R473K probably benign Het
March1 A G 8: 66,468,390 T495A probably damaging Het
Marveld3 T G 8: 109,948,542 probably null Het
Mbd3 T C 10: 80,394,586 D160G possibly damaging Het
Mrc2 T G 11: 105,347,725 C1233G probably damaging Het
Ms4a13 T G 19: 11,183,861 T105P probably damaging Het
Mtbp T C 15: 55,617,555 Y306H probably damaging Het
Muc3a T C 5: 137,210,501 probably benign Het
Myo1g T A 11: 6,520,811 Y15F probably benign Het
Nae1 A T 8: 104,523,584 Y226N probably benign Het
Nlrp9a A G 7: 26,567,891 S715G probably benign Het
Olfr1193 T A 2: 88,677,875 S7T possibly damaging Het
Olfr338 A T 2: 36,377,621 M282L probably benign Het
Olfr699 T C 7: 106,790,821 Y60C probably damaging Het
Olfr844 A T 9: 19,319,316 S267C probably damaging Het
Olfr972 G T 9: 39,873,411 M45I probably benign Het
Pex5l T C 3: 33,014,980 T123A probably damaging Het
Pip5kl1 A T 2: 32,576,679 N62I probably benign Het
Pkhd1l1 T C 15: 44,545,494 V2459A probably damaging Het
Prb1 T A 6: 132,207,476 Q398L unknown Het
Prkab2 T C 3: 97,663,947 L165S probably damaging Het
Prl3d2 C G 13: 27,121,706 probably benign Het
Ptdss1 G A 13: 66,995,408 G435D probably benign Het
Qrfpr A G 3: 36,182,580 L224P probably damaging Het
Rasl2-9 C T 7: 5,125,442 W163* probably null Het
Rgs5 A G 1: 169,690,414 probably null Het
Rnf19b T C 4: 129,078,961 L255P probably damaging Het
Rp9 A C 9: 22,457,455 N69K probably damaging Het
Sh3bp4 G T 1: 89,145,488 S686I probably damaging Het
Spp2 C A 1: 88,412,293 Q5K possibly damaging Het
Svep1 C T 4: 58,070,239 G2516R probably damaging Het
Syncrip A C 9: 88,479,896 S55R probably damaging Het
Tacc3 T C 5: 33,661,308 L29P probably damaging Het
Tex15 A G 8: 33,575,092 T1517A probably damaging Het
Tmem140 A G 6: 34,872,725 M59V probably benign Het
Ttn G T 2: 76,745,528 A25007E probably damaging Het
Unc80 C T 1: 66,521,581 H823Y possibly damaging Het
Usp38 A G 8: 80,995,770 L374P probably damaging Het
Vmn1r42 T A 6: 89,845,501 I29L probably benign Het
Vmn2r94 C T 17: 18,256,980 V390M probably benign Het
Vmp1 A G 11: 86,661,200 Y113H possibly damaging Het
Wdr20 T C 12: 110,794,030 M450T probably benign Het
Ylpm1 T C 12: 85,014,996 V557A unknown Het
Zpld1 T C 16: 55,233,572 N286D probably damaging Het
Other mutations in Ubr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00324:Ubr2 APN 17 46986060 splice site probably benign
IGL00332:Ubr2 APN 17 46990990 critical splice donor site probably null
IGL00518:Ubr2 APN 17 46992996 missense probably damaging 1.00
IGL00693:Ubr2 APN 17 46972981 missense probably benign 0.01
IGL00785:Ubr2 APN 17 46944865 missense possibly damaging 0.69
IGL01144:Ubr2 APN 17 46957321 missense probably damaging 1.00
IGL01459:Ubr2 APN 17 46930509 splice site probably benign
IGL01637:Ubr2 APN 17 46956654 missense probably damaging 1.00
IGL01710:Ubr2 APN 17 46943409 missense probably benign 0.00
IGL01726:Ubr2 APN 17 46992981 splice site probably benign
IGL01925:Ubr2 APN 17 46954949 missense possibly damaging 0.92
IGL01960:Ubr2 APN 17 46973967 missense probably benign 0.45
IGL02170:Ubr2 APN 17 46967197 missense probably benign 0.05
IGL02308:Ubr2 APN 17 46934193 missense probably damaging 1.00
IGL02387:Ubr2 APN 17 46963150 missense probably benign
IGL02696:Ubr2 APN 17 46963765 missense probably benign
IGL02726:Ubr2 APN 17 46972921 missense probably damaging 1.00
IGL02750:Ubr2 APN 17 46969282 missense probably benign 0.00
IGL02934:Ubr2 APN 17 46957340 missense possibly damaging 0.50
IGL02959:Ubr2 APN 17 46975951 missense probably damaging 0.96
IGL03018:Ubr2 APN 17 46954046 missense possibly damaging 0.64
IGL03343:Ubr2 APN 17 46951918 missense probably benign 0.00
PIT4280001:Ubr2 UTSW 17 46944863 missense probably damaging 1.00
R0044:Ubr2 UTSW 17 46992985 splice site probably benign
R0044:Ubr2 UTSW 17 46992985 splice site probably benign
R0446:Ubr2 UTSW 17 46983298 missense probably damaging 1.00
R0513:Ubr2 UTSW 17 46986779 nonsense probably null
R0565:Ubr2 UTSW 17 46955886 missense probably damaging 1.00
R0600:Ubr2 UTSW 17 46967248 missense probably damaging 0.99
R0690:Ubr2 UTSW 17 46938653 missense probably damaging 0.97
R0710:Ubr2 UTSW 17 46938681 missense probably damaging 0.96
R0761:Ubr2 UTSW 17 46983316 missense probably damaging 1.00
R0798:Ubr2 UTSW 17 46969176 splice site probably benign
R0862:Ubr2 UTSW 17 46967083 nonsense probably null
R0947:Ubr2 UTSW 17 46941112 missense probably damaging 0.99
R0972:Ubr2 UTSW 17 46934261 intron probably null
R1514:Ubr2 UTSW 17 47000823 missense probably damaging 1.00
R1533:Ubr2 UTSW 17 46967247 nonsense probably null
R1554:Ubr2 UTSW 17 46972951 missense probably benign
R1575:Ubr2 UTSW 17 46932492 missense probably damaging 1.00
R1602:Ubr2 UTSW 17 46941061 missense probably benign 0.30
R1941:Ubr2 UTSW 17 46974026 missense probably damaging 1.00
R1966:Ubr2 UTSW 17 46954919 missense probably benign 0.05
R2041:Ubr2 UTSW 17 46986047 missense probably damaging 1.00
R2067:Ubr2 UTSW 17 46963145 critical splice donor site probably null
R2111:Ubr2 UTSW 17 46963145 critical splice donor site probably null
R2189:Ubr2 UTSW 17 46943364 missense probably benign 0.01
R2219:Ubr2 UTSW 17 46986042 missense possibly damaging 0.94
R2307:Ubr2 UTSW 17 46966215 nonsense probably null
R3426:Ubr2 UTSW 17 46968439 missense probably damaging 1.00
R3428:Ubr2 UTSW 17 46968439 missense probably damaging 1.00
R3608:Ubr2 UTSW 17 46944523 missense probably damaging 1.00
R4080:Ubr2 UTSW 17 46988722 missense probably benign 0.05
R4330:Ubr2 UTSW 17 46967278 missense probably null 1.00
R4383:Ubr2 UTSW 17 46939387 missense probably benign 0.01
R4460:Ubr2 UTSW 17 46945045 critical splice donor site probably null
R4794:Ubr2 UTSW 17 46930445 missense probably damaging 1.00
R4902:Ubr2 UTSW 17 46985996 missense possibly damaging 0.91
R4913:Ubr2 UTSW 17 46959459 splice site probably null
R5092:Ubr2 UTSW 17 46969247 missense probably damaging 1.00
R5209:Ubr2 UTSW 17 46968424 missense probably damaging 1.00
R5226:Ubr2 UTSW 17 46983270 missense probably benign 0.04
R5250:Ubr2 UTSW 17 46930442 missense probably benign 0.01
R5437:Ubr2 UTSW 17 46963697 missense probably benign 0.00
R5607:Ubr2 UTSW 17 46934200 nonsense probably null
R5848:Ubr2 UTSW 17 46956655 missense possibly damaging 0.84
R6089:Ubr2 UTSW 17 46982292 missense possibly damaging 0.95
R6382:Ubr2 UTSW 17 46957315 missense possibly damaging 0.56
R6552:Ubr2 UTSW 17 46966268 splice site probably null
R6630:Ubr2 UTSW 17 46951984 missense possibly damaging 0.51
R6892:Ubr2 UTSW 17 46934108 missense probably damaging 0.99
R6936:Ubr2 UTSW 17 46973031 missense possibly damaging 0.94
R7039:Ubr2 UTSW 17 47010213 missense probably benign 0.01
R7050:Ubr2 UTSW 17 46961602 missense probably benign 0.30
R7078:Ubr2 UTSW 17 46955853 missense possibly damaging 0.59
R7126:Ubr2 UTSW 17 46974056 splice site probably null
R7219:Ubr2 UTSW 17 46935434 nonsense probably null
R7262:Ubr2 UTSW 17 47000739 missense probably damaging 0.97
R7352:Ubr2 UTSW 17 46930426 missense probably benign 0.19
R7366:Ubr2 UTSW 17 46955845 missense probably damaging 0.99
R7449:Ubr2 UTSW 17 46964788 missense probably damaging 1.00
R7496:Ubr2 UTSW 17 46990991 critical splice donor site probably null
R7759:Ubr2 UTSW 17 46986048 missense probably damaging 1.00
R7869:Ubr2 UTSW 17 46991008 missense probably benign 0.00
R7952:Ubr2 UTSW 17 46991008 missense probably benign 0.00
X0027:Ubr2 UTSW 17 47000629 missense probably damaging 0.99
X0061:Ubr2 UTSW 17 46970111 missense possibly damaging 0.88
Z1177:Ubr2 UTSW 17 46959509 missense probably benign
Z1177:Ubr2 UTSW 17 47000766 missense possibly damaging 0.76
Z1177:Ubr2 UTSW 17 47010143 missense probably benign 0.33
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- ccagactttgggaggtagaaac -3'
Posted On2014-04-13