Incidental Mutation 'R1626:Pole'
ID 172493
Institutional Source Beutler Lab
Gene Symbol Pole
Ensembl Gene ENSMUSG00000007080
Gene Name polymerase (DNA directed), epsilon
Synonyms pol-epsilon
MMRRC Submission 039663-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R1626 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 110286306-110337474 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 110293369 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Leucine at position 230 (I230L)
Ref Sequence ENSEMBL: ENSMUSP00000007296 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007296] [ENSMUST00000112482]
AlphaFold Q9WVF7
Predicted Effect probably benign
Transcript: ENSMUST00000007296
AA Change: I230L

PolyPhen 2 Score 0.246 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000007296
Gene: ENSMUSG00000007080
AA Change: I230L

DomainStartEndE-ValueType
POLBc 267 870 9.42e-97 SMART
Blast:POLBc 903 970 1e-28 BLAST
Blast:POLBc 1014 1073 2e-22 BLAST
Blast:POLBc 1195 1266 7e-21 BLAST
low complexity region 1275 1294 N/A INTRINSIC
Blast:DUF1744 1401 1430 2e-7 BLAST
DUF1744 1524 1924 1.9e-236 SMART
coiled coil region 1936 1963 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112482
SMART Domains Protein: ENSMUSP00000108101
Gene: ENSMUSG00000007080

DomainStartEndE-ValueType
Pfam:DNA_pol_B_exo1 86 190 1.5e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131887
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 90.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the catalytic subunit of DNA polymerase epsilon. The enzyme is involved in DNA repair and chromosomal DNA replication. Mutations in this gene have been associated with colorectal cancer 12 and facial dysmorphism, immunodeficiency, livedo, and short stature. [provided by RefSeq, Sep 2013]
PHENOTYPE: Mice homozygous for a knock-in allele exhibit increased incidence of tumors and premature death. Mice homozygous for a transgenic gene disruption exhibit embryonic lethality at E7. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020N01Rik T C 10: 21,621,672 Y71H possibly damaging Het
Acsl6 C A 11: 54,352,046 P628T probably damaging Het
Ak7 A G 12: 105,768,548 D591G probably benign Het
Anxa5 T C 3: 36,461,981 D66G probably damaging Het
Cacna1b G A 2: 24,606,709 T2283I probably damaging Het
Cand1 A T 10: 119,210,014 D995E possibly damaging Het
Cblc G T 7: 19,796,502 A94E probably damaging Het
Cd48 G A 1: 171,682,119 C9Y probably benign Het
Chd9 A G 8: 90,994,596 K1004R probably benign Het
Cldn1 T C 16: 26,371,452 T59A probably damaging Het
Col11a1 G A 3: 114,131,569 G17D probably damaging Het
Cpeb1 A G 7: 81,436,247 V49A probably damaging Het
Cyp4b1 G T 4: 115,641,658 P109Q probably damaging Het
Dhrs7b T A 11: 60,844,256 F23I possibly damaging Het
Dnah9 C A 11: 66,085,267 A1319S probably benign Het
Egf A T 3: 129,686,215 V553D possibly damaging Het
Fbn1 T C 2: 125,341,279 D1760G probably damaging Het
Fbxo31 A G 8: 121,560,006 F178L probably damaging Het
Fstl4 C A 11: 53,000,290 S85* probably null Het
Gfm1 A G 3: 67,438,644 Y225C probably damaging Het
Gm10797 A T 10: 67,572,623 noncoding transcript Het
Heatr4 T A 12: 83,973,721 I499L probably benign Het
Hist1h3g G A 13: 23,535,551 V36M probably damaging Het
Ick A G 9: 78,150,637 Y156C probably damaging Het
Igfn1 A T 1: 135,968,967 M1287K probably benign Het
Inpp5b C A 4: 124,783,903 D385E probably damaging Het
Lrrc9 A G 12: 72,495,661 probably null Het
Ltb4r1 A G 14: 55,767,242 M1V probably null Het
Macf1 T C 4: 123,471,534 I3145V probably benign Het
Man2a2 T C 7: 80,367,702 N277S probably damaging Het
Megf6 G T 4: 154,177,121 V68L probably benign Het
Mgat4e A G 1: 134,541,278 Y343H probably benign Het
Noxred1 T C 12: 87,221,255 *367W probably null Het
Nupl1 A T 14: 60,242,627 L190* probably null Het
Olfml2a G T 2: 38,951,263 K270N probably damaging Het
Olfr368 A G 2: 37,332,762 probably null Het
Olfr850 A G 9: 19,478,199 L14P probably damaging Het
Phgdh G T 3: 98,316,409 Q359K probably benign Het
Plpp5 G T 8: 25,722,577 C200F possibly damaging Het
Prtg A T 9: 72,844,911 D193V probably damaging Het
Ptgs2 G A 1: 150,103,868 probably null Het
Ptprz1 A T 6: 23,001,574 Q1221L probably benign Het
Rufy2 T C 10: 62,995,372 I204T probably benign Het
Rybp A G 6: 100,232,958 S115P possibly damaging Het
Samd13 A G 3: 146,662,726 V37A probably benign Het
Secisbp2l T G 2: 125,775,686 K24Q probably damaging Het
Sorbs2 A G 8: 45,769,854 Y198C probably damaging Het
Svil T G 18: 5,117,099 probably null Het
Ttc24 G T 3: 88,070,059 R127S probably benign Het
Ttn C T 2: 76,758,544 V21394M probably damaging Het
Tubal3 G T 13: 3,932,841 C207F probably damaging Het
Vmn2r16 A T 5: 109,363,577 D550V probably damaging Het
Vmn2r2 T A 3: 64,134,500 I265F possibly damaging Het
Zfp507 T C 7: 35,795,433 K62E probably damaging Het
Other mutations in Pole
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:Pole APN 5 110303565 splice site probably benign
IGL00475:Pole APN 5 110291096 nonsense probably null
IGL00837:Pole APN 5 110302009 missense possibly damaging 0.91
IGL00976:Pole APN 5 110323572 missense probably benign 0.00
IGL01081:Pole APN 5 110337240 missense possibly damaging 0.92
IGL01503:Pole APN 5 110303884 missense probably damaging 1.00
IGL01640:Pole APN 5 110298266 missense probably null 0.08
IGL01987:Pole APN 5 110337232 missense probably benign 0.01
IGL02429:Pole APN 5 110299800 missense probably benign
IGL02733:Pole APN 5 110312728 splice site probably benign
IGL03102:Pole APN 5 110297073 missense probably damaging 1.00
IGL03157:Pole APN 5 110293753 missense probably benign
IGL03186:Pole APN 5 110299920 critical splice donor site probably null
IGL03271:Pole APN 5 110318319 missense probably benign
IGL03351:Pole APN 5 110301998 splice site probably benign
IGL03408:Pole APN 5 110294560 missense probably damaging 1.00
IGL03410:Pole APN 5 110324559 missense probably benign
ANU74:Pole UTSW 5 110289370 missense probably benign 0.44
PIT4495001:Pole UTSW 5 110303914 missense probably damaging 1.00
R0053:Pole UTSW 5 110293340 missense probably damaging 1.00
R0053:Pole UTSW 5 110293340 missense probably damaging 1.00
R0124:Pole UTSW 5 110303992 missense probably damaging 0.96
R0145:Pole UTSW 5 110324425 missense probably damaging 0.99
R0523:Pole UTSW 5 110303593 missense probably damaging 0.96
R0590:Pole UTSW 5 110317926 missense probably benign
R0625:Pole UTSW 5 110325550 missense possibly damaging 0.50
R0707:Pole UTSW 5 110298988 missense probably damaging 1.00
R1160:Pole UTSW 5 110295253 missense possibly damaging 0.85
R1320:Pole UTSW 5 110309129 frame shift probably null
R1384:Pole UTSW 5 110323664 missense possibly damaging 0.81
R1643:Pole UTSW 5 110317845 missense probably damaging 1.00
R1655:Pole UTSW 5 110335922 missense probably damaging 1.00
R1668:Pole UTSW 5 110297369 missense probably damaging 1.00
R1783:Pole UTSW 5 110297430 missense probably damaging 1.00
R1843:Pole UTSW 5 110330835 critical splice donor site probably null
R1853:Pole UTSW 5 110306853 missense possibly damaging 0.95
R1867:Pole UTSW 5 110334197 missense probably benign 0.08
R1874:Pole UTSW 5 110323664 missense possibly damaging 0.81
R1891:Pole UTSW 5 110332542 missense probably damaging 1.00
R1928:Pole UTSW 5 110327778 missense probably benign
R2073:Pole UTSW 5 110325551 missense probably damaging 0.99
R2341:Pole UTSW 5 110330963 missense possibly damaging 0.67
R2448:Pole UTSW 5 110297092 missense probably damaging 1.00
R2504:Pole UTSW 5 110290502 splice site probably null
R3053:Pole UTSW 5 110289795 missense probably damaging 1.00
R3892:Pole UTSW 5 110336439 missense probably damaging 1.00
R3964:Pole UTSW 5 110312782 missense probably damaging 1.00
R3965:Pole UTSW 5 110312782 missense probably damaging 1.00
R4374:Pole UTSW 5 110337205 missense possibly damaging 0.89
R4376:Pole UTSW 5 110337205 missense possibly damaging 0.89
R4377:Pole UTSW 5 110337205 missense possibly damaging 0.89
R4520:Pole UTSW 5 110297924 missense probably damaging 1.00
R4670:Pole UTSW 5 110306387 missense probably benign 0.01
R4778:Pole UTSW 5 110330832 missense probably benign 0.00
R4887:Pole UTSW 5 110324753 missense probably damaging 0.99
R4898:Pole UTSW 5 110290224 critical splice acceptor site probably null
R5184:Pole UTSW 5 110294934 missense possibly damaging 0.91
R5359:Pole UTSW 5 110332488 missense probably benign 0.03
R5483:Pole UTSW 5 110294568 missense probably damaging 1.00
R5529:Pole UTSW 5 110332466 missense probably benign 0.20
R5576:Pole UTSW 5 110312065 nonsense probably null
R5817:Pole UTSW 5 110312972 missense probably damaging 1.00
R5877:Pole UTSW 5 110332463 missense probably benign
R5956:Pole UTSW 5 110337287 unclassified probably benign
R5990:Pole UTSW 5 110302144 missense probably damaging 1.00
R6019:Pole UTSW 5 110324514 missense probably benign 0.01
R6019:Pole UTSW 5 110324515 missense probably benign 0.01
R6093:Pole UTSW 5 110312090 missense probably benign 0.01
R6376:Pole UTSW 5 110336374 missense probably damaging 0.99
R6494:Pole UTSW 5 110324722 missense possibly damaging 0.86
R6535:Pole UTSW 5 110324807 missense probably damaging 1.00
R6723:Pole UTSW 5 110323616 missense probably benign 0.11
R6757:Pole UTSW 5 110303610 missense probably damaging 1.00
R6930:Pole UTSW 5 110293290 missense probably benign 0.01
R6988:Pole UTSW 5 110329583 missense probably damaging 0.97
R6992:Pole UTSW 5 110332499 missense probably damaging 0.99
R7067:Pole UTSW 5 110334218 missense probably damaging 1.00
R7097:Pole UTSW 5 110325102 splice site probably null
R7122:Pole UTSW 5 110325102 splice site probably null
R7202:Pole UTSW 5 110297107 missense possibly damaging 0.94
R7340:Pole UTSW 5 110334464 missense probably benign 0.06
R7345:Pole UTSW 5 110303903 missense possibly damaging 0.82
R7509:Pole UTSW 5 110330705 start gained probably benign
R7557:Pole UTSW 5 110312994 missense probably damaging 1.00
R7740:Pole UTSW 5 110331041 missense probably benign 0.00
R7792:Pole UTSW 5 110297466 splice site probably null
R7832:Pole UTSW 5 110317797 missense probably benign 0.00
R7849:Pole UTSW 5 110332548 missense probably benign 0.04
R7852:Pole UTSW 5 110306829 missense probably damaging 1.00
R7960:Pole UTSW 5 110289861 missense possibly damaging 0.81
R8001:Pole UTSW 5 110312734 missense probably damaging 1.00
R8266:Pole UTSW 5 110294920 missense probably damaging 1.00
R8510:Pole UTSW 5 110334446 missense probably damaging 0.99
R8793:Pole UTSW 5 110297748 missense probably damaging 1.00
R8835:Pole UTSW 5 110306909 missense probably damaging 1.00
R8863:Pole UTSW 5 110289367 missense possibly damaging 0.94
R8929:Pole UTSW 5 110297788 missense probably damaging 0.98
R8968:Pole UTSW 5 110312083 missense possibly damaging 0.78
R8992:Pole UTSW 5 110323622 missense possibly damaging 0.88
R9018:Pole UTSW 5 110289809 missense probably benign 0.37
R9177:Pole UTSW 5 110332422 missense probably benign 0.04
R9250:Pole UTSW 5 110299821 missense possibly damaging 0.88
R9262:Pole UTSW 5 110325556 missense probably damaging 0.99
R9262:Pole UTSW 5 110325557 missense probably damaging 1.00
R9367:Pole UTSW 5 110297089 missense probably damaging 0.99
R9383:Pole UTSW 5 110291026 missense possibly damaging 0.61
R9626:Pole UTSW 5 110312093 missense possibly damaging 0.68
X0064:Pole UTSW 5 110317904 nonsense probably null
Y5377:Pole UTSW 5 110294891 critical splice acceptor site probably null
Y5380:Pole UTSW 5 110294891 critical splice acceptor site probably null
Z1088:Pole UTSW 5 110327865 missense possibly damaging 0.66
Z1177:Pole UTSW 5 110297009 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGGTGGTGATCCAAGGCCATTTC -3'
(R):5'- CATCTCGTCGGGTGATTTCCACAG -3'

Sequencing Primer
(F):5'- TGAGAGATGACCCTGGTCCTTAC -3'
(R):5'- ttctctttccactaccgcag -3'
Posted On 2014-04-24