Mutagenetix > Incidental Mutation

Incidental Mutation 'R1570:Gnptab'

177195

Institutional Source

Beutler Lab

Gene Symbol

Gnptab

Ensembl Gene

ENSMUSG00000035311

Gene Name

N-acetylglucosamine-1-phosphate transferase, alpha and beta subunits

Synonyms

EG432486

MMRRC Submission

039609-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.940) question?

Stock #

R1570 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

88379132-88447329 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 88419454 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Glutamic Acid at position 222 (V222E)

Ref Sequence

ENSEMBL: ENSMUSP00000020251 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020251] [ENSMUST00000127615] [ENSMUST00000130301] [ENSMUST00000151273]

AlphaFold

Q69ZN6

Predicted Effect

probably damaging
Transcript: ENSMUST00000020251
AA Change: V222E

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000020251
Gene: ENSMUSG00000035311
AA Change: V222E

Domain	Start	End	E-Value	Type
transmembrane domain	20	42	N/A	INTRINSIC
Pfam:Stealth_CR1	73	101	6.6e-14	PFAM
Pfam:Stealth_CR2	322	429	8.8e-49	PFAM
NL	431	469	3.82e-7	SMART
low complexity region	480	490	N/A	INTRINSIC
NL	498	536	2.37e-2	SMART
DMAP_binding	699	813	6.14e-38	SMART
Pfam:Stealth_CR3	934	982	2.9e-21	PFAM
Pfam:Stealth_CR4	1117	1173	7.9e-28	PFAM
transmembrane domain	1192	1214	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000127615

SMART Domains

Protein: ENSMUSP00000116915
Gene: ENSMUSG00000035311

Domain	Start	End	E-Value	Type
transmembrane domain	2	24	N/A	INTRINSIC
coiled coil region	71	98	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000130301

SMART Domains

Protein: ENSMUSP00000120643
Gene: ENSMUSG00000035311

Domain	Start	End	E-Value	Type
transmembrane domain	7	29	N/A	INTRINSIC
coiled coil region	77	104	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000151273

SMART Domains

Protein: ENSMUSP00000118025
Gene: ENSMUSG00000035311

Domain	Start	End	E-Value	Type
transmembrane domain	13	35	N/A	INTRINSIC

Meta Mutation Damage Score

0.4125

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.6%
20x: 90.0%

Validation Efficiency

93% (77/83)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes two of three subunit types of the membrane-bound enzyme N-acetylglucosamine-1-phosphotransferase, a heterohexameric complex composed of two alpha, two beta, and two gamma subunits. The encoded protein is proteolytically cleaved at the Lys928-Asp929 bond to yield mature alpha and beta polypeptides while the gamma subunits are the product of a distinct gene (GeneID 84572). In the Golgi apparatus, the heterohexameric complex catalyzes the first step in the synthesis of mannose 6-phosphate recognition markers on certain oligosaccharides of newly synthesized lysosomal enzymes. These recognition markers are essential for appropriate trafficking of lysosomal enzymes. Mutations in this gene have been associated with both mucolipidosis II and mucolipidosis IIIA.[provided by RefSeq, May 2010]
PHENOTYPE: Homozygous mutations cause stunted growth, high lysosomal enzyme levels, skeletal defects, retinal degeneration and secretory cell lesions. Homozygotes for an ENU allele show skeletal and facial defects, altered enzymatic activities, lysosomal storage, Purkinje cell loss, ataxia and premature death. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Apobec1	A	G	6: 122,591,085		probably null	Het
Arhgap21	G	T	2: 20,880,840	Q348K	probably benign	Het
Arl5c	A	G	11: 97,992,387	V129A	probably benign	Het
Armh1	A	G	4: 117,229,992	S159P	probably damaging	Het
Asb8	A	G	15: 98,136,428	L82P	probably damaging	Het
Bahcc1	G	A	11: 120,272,183	A436T	possibly damaging	Het
Btc	T	C	5: 91,402,717	D2G	unknown	Het
C1s2	G	A	6: 124,625,764	T490M	probably benign	Het
Caap1	C	T	4: 94,556,577	G43D	probably benign	Het
Ccr5	T	C	9: 124,124,963	V201A	probably benign	Het
Cd109	CATTTATTTATTTATTTATTTATTTATTTATTTAT	CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT	9: 78,712,500		probably benign	Het
Cdhr5	C	A	7: 141,271,769	G541C	probably damaging	Het
Cep170	A	G	1: 176,755,801	I1004T	possibly damaging	Het
Chd9	A	T	8: 91,036,542	M2332L	probably benign	Het
Clk1	T	A	1: 58,414,425	H334L	probably benign	Het
Cyp4b1	G	A	4: 115,635,963	S228F	probably benign	Het
Dnah9	T	C	11: 66,112,330	N883D	probably benign	Het
Dync2h1	A	G	9: 7,176,926	L11P	probably benign	Het
Ephx4	A	G	5: 107,419,851	E225G	probably damaging	Het
Erich6	C	T	3: 58,630,659		probably null	Het
Espl1	A	G	15: 102,298,367	T89A	probably damaging	Het
Evi2	T	A	11: 79,516,250	K166N	possibly damaging	Het
Glrx5	A	G	12: 105,032,868	T57A	possibly damaging	Het
Gm15448	T	C	7: 3,823,061	E311G	probably benign	Het
Gm884	A	G	11: 103,609,938	Y597H	possibly damaging	Het
Gpr155	T	C	2: 73,370,038	Y375C	possibly damaging	Het
Hsd11b1	C	G	1: 193,240,327	E141Q	probably damaging	Het
Ildr2	T	C	1: 166,303,585	F337L	probably damaging	Het
Ino80	C	T	2: 119,447,028	R322Q	possibly damaging	Het
Lcp2	A	G	11: 34,089,601	D467G	probably benign	Het
Lmbr1	A	G	5: 29,254,558	I229T	probably damaging	Het
Lnpep	A	T	17: 17,579,156	M79K	probably damaging	Het
Lpin1	T	C	12: 16,560,998	Q564R	possibly damaging	Het
Lpin2	T	A	17: 71,245,181	L794*	probably null	Het
Lrrc45	T	C	11: 120,720,109		probably null	Het
Mtus1	A	G	8: 41,076,241	S751P	probably damaging	Het
Nbr1	T	C	11: 101,564,830		probably benign	Het
Nup107	A	G	10: 117,763,844	F592S	possibly damaging	Het
Nup133	T	A	8: 123,949,176	M1L	possibly damaging	Het
Olfr1104	A	T	2: 87,022,272	S91T	probably benign	Het
Olfr1208	A	C	2: 88,896,946	I217S	probably damaging	Het
Olfr139	A	C	11: 74,044,807	F156V	possibly damaging	Het
Olfr434	T	C	6: 43,217,351	V146A	probably benign	Het
Olfr548-ps1	C	A	7: 102,541,970	H11Q	probably damaging	Het
Olfr732	T	G	14: 50,281,524	H243P	probably damaging	Het
Otud7b	T	C	3: 96,155,891	C816R	probably damaging	Het
Pi4k2a	T	C	19: 42,100,644	V148A	probably benign	Het
Pih1d2	T	C	9: 50,621,179	M195T	probably benign	Het
Plpp6	T	C	19: 28,964,778	F260L	probably damaging	Het
R3hcc1l	A	T	19: 42,581,954	T663S	probably damaging	Het
Rnf25	T	C	1: 74,595,267	E199G	probably damaging	Het
Scin	G	A	12: 40,084,381		probably benign	Het
Serpinb1c	A	T	13: 32,896,990	S37T	probably benign	Het
Snx19	A	G	9: 30,428,343	D259G	probably damaging	Het
Sorcs3	A	G	19: 48,764,181	K805R	probably damaging	Het
Sox6	C	A	7: 115,777,123	G125W	probably damaging	Het
Spink5	A	G	18: 43,967,107	I64V	probably benign	Het
St6galnac1	A	G	11: 116,766,648		probably benign	Het
Sult1c2	T	C	17: 53,836,963	I105V	probably benign	Het
Tacr3	T	G	3: 134,829,756	S162A	probably damaging	Het
Tex43	T	A	18: 56,594,534	D101E	probably benign	Het
Ttc6	T	C	12: 57,674,763	S1013P	probably damaging	Het
Zbtb11	C	A	16: 55,990,815	N445K	probably benign	Het
Zfp423	A	C	8: 87,782,558	V261G	probably benign	Het
Zfp59	T	C	7: 27,853,591	V156A	probably benign	Het
Zscan2	C	A	7: 80,863,393	A42E	probably damaging	Het

Other mutations in Gnptab

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01326:Gnptab	APN	10	88433065	missense	probably damaging	0.99
IGL01346:Gnptab	APN	10	88436179	missense	possibly damaging	0.65
IGL01626:Gnptab	APN	10	88437495	missense	probably damaging	0.98
IGL01642:Gnptab	APN	10	88436132	missense	possibly damaging	0.89
IGL02121:Gnptab	APN	10	88429461	missense	possibly damaging	0.90
IGL03076:Gnptab	APN	10	88440289	missense	possibly damaging	0.91
IGL03130:Gnptab	APN	10	88436371	missense	possibly damaging	0.95
maze	UTSW	10	88432573	missense	probably damaging	1.00
R0103:Gnptab	UTSW	10	88429519	missense	probably damaging	1.00
R0103:Gnptab	UTSW	10	88429519	missense	probably damaging	1.00
R0114:Gnptab	UTSW	10	88433400	missense	possibly damaging	0.48
R0206:Gnptab	UTSW	10	88439510	missense	probably damaging	0.98
R0288:Gnptab	UTSW	10	88433105	missense	probably benign	0.00
R0329:Gnptab	UTSW	10	88440309	missense	probably damaging	1.00
R0330:Gnptab	UTSW	10	88440309	missense	probably damaging	1.00
R0369:Gnptab	UTSW	10	88433594	missense	possibly damaging	0.87
R0385:Gnptab	UTSW	10	88436525	missense	probably damaging	1.00
R0522:Gnptab	UTSW	10	88431466	splice site	probably benign
R0569:Gnptab	UTSW	10	88428557	missense	possibly damaging	0.89
R0671:Gnptab	UTSW	10	88443304	splice site	probably benign
R0834:Gnptab	UTSW	10	88429952	missense	probably damaging	1.00
R1375:Gnptab	UTSW	10	88432573	missense	probably damaging	1.00
R1443:Gnptab	UTSW	10	88434081	missense	probably damaging	1.00
R1464:Gnptab	UTSW	10	88445754	splice site	probably benign
R1471:Gnptab	UTSW	10	88445763	missense	probably benign
R1612:Gnptab	UTSW	10	88428482	splice site	probably null
R1614:Gnptab	UTSW	10	88414589	missense	probably benign
R1638:Gnptab	UTSW	10	88436167	missense	possibly damaging	0.94
R1739:Gnptab	UTSW	10	88436095	missense	probably benign	0.14
R1894:Gnptab	UTSW	10	88419127	missense	possibly damaging	0.69
R2092:Gnptab	UTSW	10	88440305	nonsense	probably null
R2118:Gnptab	UTSW	10	88436398	missense	probably benign	0.13
R2144:Gnptab	UTSW	10	88428506	missense	possibly damaging	0.89
R2174:Gnptab	UTSW	10	88434044	missense	probably damaging	1.00
R3847:Gnptab	UTSW	10	88433577	nonsense	probably null
R3943:Gnptab	UTSW	10	88433894	missense	probably benign
R4434:Gnptab	UTSW	10	88412622	missense	probably damaging	1.00
R4545:Gnptab	UTSW	10	88414595	missense	probably benign	0.00
R4776:Gnptab	UTSW	10	88436528	missense	probably damaging	1.00
R4786:Gnptab	UTSW	10	88436182	missense	probably damaging	1.00
R4880:Gnptab	UTSW	10	88432551	nonsense	probably null
R4889:Gnptab	UTSW	10	88433913	missense	probably benign	0.00
R4923:Gnptab	UTSW	10	88429623	missense	probably benign	0.17
R5694:Gnptab	UTSW	10	88414486	missense	probably benign	0.01
R5943:Gnptab	UTSW	10	88433514	missense	probably benign	0.00
R6027:Gnptab	UTSW	10	88433225	missense	probably damaging	0.98
R6074:Gnptab	UTSW	10	88433078	missense	probably damaging	1.00
R6119:Gnptab	UTSW	10	88431395	missense	probably damaging	1.00
R6182:Gnptab	UTSW	10	88429480	missense	possibly damaging	0.71
R6757:Gnptab	UTSW	10	88437502	missense	probably damaging	0.98
R6910:Gnptab	UTSW	10	88431396	missense	probably damaging	1.00
R6911:Gnptab	UTSW	10	88431396	missense	probably damaging	1.00
R7094:Gnptab	UTSW	10	88379504	missense	possibly damaging	0.66
R7101:Gnptab	UTSW	10	88440312	missense	probably benign	0.19
R7164:Gnptab	UTSW	10	88434070	nonsense	probably null
R7214:Gnptab	UTSW	10	88379157	unclassified	probably benign
R7316:Gnptab	UTSW	10	88400710	missense	probably damaging	1.00
R7463:Gnptab	UTSW	10	88431389	missense	probably damaging	1.00
R7596:Gnptab	UTSW	10	88443370	missense	probably damaging	0.99
R7654:Gnptab	UTSW	10	88445819	missense	possibly damaging	0.63
R7722:Gnptab	UTSW	10	88379528	missense	probably damaging	0.99
R7770:Gnptab	UTSW	10	88411920	missense	probably benign	0.41
R7791:Gnptab	UTSW	10	88440222	critical splice acceptor site	probably null
R7838:Gnptab	UTSW	10	88440392	critical splice donor site	probably null
R8002:Gnptab	UTSW	10	88440268	missense	probably benign	0.14
R8168:Gnptab	UTSW	10	88419133	missense	probably benign	0.41
R8219:Gnptab	UTSW	10	88433792	missense	probably benign
R8221:Gnptab	UTSW	10	88440392	critical splice donor site	probably null
R8313:Gnptab	UTSW	10	88439209	missense	probably damaging	1.00
R8351:Gnptab	UTSW	10	88414486	missense	probably benign	0.01
R8487:Gnptab	UTSW	10	88432646	critical splice donor site	probably null
R9108:Gnptab	UTSW	10	88433538	missense
R9352:Gnptab	UTSW	10	88432488	missense	probably benign	0.05
R9489:Gnptab	UTSW	10	88433130	missense	probably damaging	1.00
R9598:Gnptab	UTSW	10	88412014	missense	probably damaging	0.97
R9760:Gnptab	UTSW	10	88431448	missense	probably damaging	1.00
R9771:Gnptab	UTSW	10	88432623	missense	probably damaging	1.00
X0064:Gnptab	UTSW	10	88436530	missense	probably damaging	1.00
X0066:Gnptab	UTSW	10	88412011	missense	probably damaging	0.99
Z1176:Gnptab	UTSW	10	88431368	missense	probably damaging	1.00
Z1177:Gnptab	UTSW	10	88440270	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CAGATGGTTTGGAGAGCCTACTTGG -3'
(R):5'- CGCACAGATCTACTTCTGACAGCAC -3'

Sequencing Primer
(F):5'- cctcgggtcttgctgtg -3'
(R):5'- TTCTGACAGCACACTGAGATG -3'

Posted On

2014-04-24