Mutagenetix > Incidental Mutation

Incidental Mutation 'R8219:Gnptab'

636565

Institutional Source

Beutler Lab

Gene Symbol

Gnptab

Ensembl Gene

ENSMUSG00000035311

Gene Name

N-acetylglucosamine-1-phosphate transferase, alpha and beta subunits

Synonyms

EG432486

MMRRC Submission

067659-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.951) question?

Stock #

R8219 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

88379132-88447329 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 88433792 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 786 (T786A)

Ref Sequence

ENSEMBL: ENSMUSP00000020251 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020251] [ENSMUST00000151273]

AlphaFold

Q69ZN6

Predicted Effect

probably benign
Transcript: ENSMUST00000020251
AA Change: T786A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000020251
Gene: ENSMUSG00000035311
AA Change: T786A

Domain	Start	End	E-Value	Type
transmembrane domain	20	42	N/A	INTRINSIC
Pfam:Stealth_CR1	73	101	6.6e-14	PFAM
Pfam:Stealth_CR2	322	429	8.8e-49	PFAM
NL	431	469	3.82e-7	SMART
low complexity region	480	490	N/A	INTRINSIC
NL	498	536	2.37e-2	SMART
DMAP_binding	699	813	6.14e-38	SMART
Pfam:Stealth_CR3	934	982	2.9e-21	PFAM
Pfam:Stealth_CR4	1117	1173	7.9e-28	PFAM
transmembrane domain	1192	1214	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000151273

SMART Domains

Protein: ENSMUSP00000118025
Gene: ENSMUSG00000035311

Domain	Start	End	E-Value	Type
transmembrane domain	13	35	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.8%
10x: 99.5%
20x: 98.7%

Validation Efficiency

100% (62/62)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes two of three subunit types of the membrane-bound enzyme N-acetylglucosamine-1-phosphotransferase, a heterohexameric complex composed of two alpha, two beta, and two gamma subunits. The encoded protein is proteolytically cleaved at the Lys928-Asp929 bond to yield mature alpha and beta polypeptides while the gamma subunits are the product of a distinct gene (GeneID 84572). In the Golgi apparatus, the heterohexameric complex catalyzes the first step in the synthesis of mannose 6-phosphate recognition markers on certain oligosaccharides of newly synthesized lysosomal enzymes. These recognition markers are essential for appropriate trafficking of lysosomal enzymes. Mutations in this gene have been associated with both mucolipidosis II and mucolipidosis IIIA.[provided by RefSeq, May 2010]
PHENOTYPE: Homozygous mutations cause stunted growth, high lysosomal enzyme levels, skeletal defects, retinal degeneration and secretory cell lesions. Homozygotes for an ENU allele show skeletal and facial defects, altered enzymatic activities, lysosomal storage, Purkinje cell loss, ataxia and premature death. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933414I15Rik	A	T	11: 50,942,536	S80T	unknown	Het
Acnat1	T	A	4: 49,447,748	I278F	probably benign	Het
Adgrf5	A	T	17: 43,449,859	Q815L	probably benign	Het
Aff1	T	A	5: 103,846,333	Y1022N	probably damaging	Het
Ahi1	A	G	10: 21,074,436	K1034E	probably benign	Het
Ano8	A	T	8: 71,480,713	L645Q	unknown	Het
Atg9b	A	G	5: 24,386,332	L756P	probably damaging	Het
Atp2b2	A	T	6: 113,793,850	I411N	probably damaging	Het
BC080695	T	G	4: 143,571,960	Y158D	probably benign	Het
Bmp6	T	A	13: 38,345,987	C19S	unknown	Het
Borcs5	A	G	6: 134,644,350	H27R	probably benign	Het
C77080	T	A	4: 129,248,153	D65V	possibly damaging	Het
Cachd1	C	A	4: 100,990,962	D1091E	probably benign	Het
Ccdc186	T	A	19: 56,793,345	M801L	probably benign	Het
Clcn3	A	T	8: 60,922,966	M658K	probably damaging	Het
Col1a1	C	T	11: 94,943,358	R500C	probably damaging	Het
Cul4a	T	A	8: 13,146,540	D731E	possibly damaging	Het
Dnajb8	C	T	6: 88,222,958	R159C	possibly damaging	Het
E2f7	T	A	10: 110,759,843	V133E	probably damaging	Het
Fam161b	T	C	12: 84,346,874	E575G	probably benign	Het
Fubp1	T	A	3: 152,220,466	V275D	probably damaging	Het
Gabrg1	T	A	5: 70,774,300	R367*	probably null	Het
Gm6902	G	A	7: 23,273,718	A128V	probably benign	Het
Golga2	A	G	2: 32,306,480	N981D	probably damaging	Het
Gsap	A	T	5: 21,251,115	I437L	probably benign	Het
Gulp1	A	G	1: 44,754,341		probably null	Het
Kcnn1	T	C	8: 70,852,855	Y237C	probably damaging	Het
Klhl28	A	T	12: 64,951,657	N354K	probably benign	Het
Lama3	T	C	18: 12,439,360	Y541H	probably benign	Het
Lamc1	A	G	1: 153,247,327	Y706H	probably damaging	Het
Lima1	G	T	15: 99,780,790	T590K	probably damaging	Het
Lrrc38	G	A	4: 143,350,733	G189R	probably damaging	Het
Mrgprb8	G	A	7: 48,388,901	V107M	possibly damaging	Het
Mrpl3	T	A	9: 105,057,072	N139K	possibly damaging	Het
Nudt16	T	A	9: 105,130,437	N161I	probably damaging	Het
Obscn	G	A	11: 59,122,748	S1091L	probably benign	Het
Olfr1458	A	C	19: 13,102,920	L122R	probably damaging	Het
Olfr894	A	C	9: 38,219,372	D183A	probably damaging	Het
Oog4	T	C	4: 143,439,938	M99V	probably benign	Het
Osbpl6	A	T	2: 76,555,903	D303V	probably damaging	Het
Pcdhb21	T	C	18: 37,514,655	F279S	probably damaging	Het
Peg3	G	A	7: 6,708,365	T1286I	probably benign	Het
Phax	A	G	18: 56,575,682	N106S	probably damaging	Het
Pkdrej	A	G	15: 85,821,292	Y148H	probably damaging	Het
Ptprn2	C	A	12: 117,184,737	Q706K	probably benign	Het
Rdh11	T	G	12: 79,189,106	K23Q	probably benign	Het
Rit2	T	A	18: 30,975,494	E146V	probably damaging	Het
Rnf141	T	C	7: 110,837,265		probably benign	Het
Sars	T	A	3: 108,445,062	E24V	probably benign	Het
Sh3tc2	A	G	18: 62,011,861	I1129V	probably benign	Het
Slc10a5	G	T	3: 10,335,324	P92Q	probably benign	Het
Slc24a5	A	T	2: 125,085,655		probably null	Het
Slc5a8	A	G	10: 88,921,699	Y517C	probably damaging	Het
Slc6a5	A	G	7: 49,912,163	M148V	probably benign	Het
Sorl1	T	C	9: 42,041,561		probably null	Het
Tgm4	A	T	9: 123,045,052	Y119F	probably benign	Het
Tgm6	A	G	2: 130,151,280	K562R	probably benign	Het
Tlr3	T	C	8: 45,397,979	E627G	possibly damaging	Het
Tmprss11f	A	G	5: 86,530,019	L297P	probably damaging	Het
Tpbgl	T	C	7: 99,625,771	H293R	probably benign	Het
Trank1	A	C	9: 111,364,909	K667T	probably damaging	Het
Trpm1	A	T	7: 64,201,951	Q139L	probably benign	Het
Ttf2	T	G	3: 100,962,563	K398T	possibly damaging	Het
Xpa	A	T	4: 46,183,150	M213K	probably benign	Het
Zmym2	T	A	14: 56,925,859	S623T	probably benign	Het

Other mutations in Gnptab

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01326:Gnptab	APN	10	88433065	missense	probably damaging	0.99
IGL01346:Gnptab	APN	10	88436179	missense	possibly damaging	0.65
IGL01626:Gnptab	APN	10	88437495	missense	probably damaging	0.98
IGL01642:Gnptab	APN	10	88436132	missense	possibly damaging	0.89
IGL02121:Gnptab	APN	10	88429461	missense	possibly damaging	0.90
IGL03076:Gnptab	APN	10	88440289	missense	possibly damaging	0.91
IGL03130:Gnptab	APN	10	88436371	missense	possibly damaging	0.95
maze	UTSW	10	88432573	missense	probably damaging	1.00
R0103:Gnptab	UTSW	10	88429519	missense	probably damaging	1.00
R0103:Gnptab	UTSW	10	88429519	missense	probably damaging	1.00
R0114:Gnptab	UTSW	10	88433400	missense	possibly damaging	0.48
R0206:Gnptab	UTSW	10	88439510	missense	probably damaging	0.98
R0288:Gnptab	UTSW	10	88433105	missense	probably benign	0.00
R0329:Gnptab	UTSW	10	88440309	missense	probably damaging	1.00
R0330:Gnptab	UTSW	10	88440309	missense	probably damaging	1.00
R0369:Gnptab	UTSW	10	88433594	missense	possibly damaging	0.87
R0385:Gnptab	UTSW	10	88436525	missense	probably damaging	1.00
R0522:Gnptab	UTSW	10	88431466	splice site	probably benign
R0569:Gnptab	UTSW	10	88428557	missense	possibly damaging	0.89
R0671:Gnptab	UTSW	10	88443304	splice site	probably benign
R0834:Gnptab	UTSW	10	88429952	missense	probably damaging	1.00
R1375:Gnptab	UTSW	10	88432573	missense	probably damaging	1.00
R1443:Gnptab	UTSW	10	88434081	missense	probably damaging	1.00
R1464:Gnptab	UTSW	10	88445754	splice site	probably benign
R1471:Gnptab	UTSW	10	88445763	missense	probably benign
R1570:Gnptab	UTSW	10	88419454	missense	probably damaging	0.99
R1612:Gnptab	UTSW	10	88428482	splice site	probably null
R1614:Gnptab	UTSW	10	88414589	missense	probably benign
R1638:Gnptab	UTSW	10	88436167	missense	possibly damaging	0.94
R1739:Gnptab	UTSW	10	88436095	missense	probably benign	0.14
R1894:Gnptab	UTSW	10	88419127	missense	possibly damaging	0.69
R2092:Gnptab	UTSW	10	88440305	nonsense	probably null
R2118:Gnptab	UTSW	10	88436398	missense	probably benign	0.13
R2144:Gnptab	UTSW	10	88428506	missense	possibly damaging	0.89
R2174:Gnptab	UTSW	10	88434044	missense	probably damaging	1.00
R3847:Gnptab	UTSW	10	88433577	nonsense	probably null
R3943:Gnptab	UTSW	10	88433894	missense	probably benign
R4434:Gnptab	UTSW	10	88412622	missense	probably damaging	1.00
R4545:Gnptab	UTSW	10	88414595	missense	probably benign	0.00
R4776:Gnptab	UTSW	10	88436528	missense	probably damaging	1.00
R4786:Gnptab	UTSW	10	88436182	missense	probably damaging	1.00
R4880:Gnptab	UTSW	10	88432551	nonsense	probably null
R4889:Gnptab	UTSW	10	88433913	missense	probably benign	0.00
R4923:Gnptab	UTSW	10	88429623	missense	probably benign	0.17
R5694:Gnptab	UTSW	10	88414486	missense	probably benign	0.01
R5943:Gnptab	UTSW	10	88433514	missense	probably benign	0.00
R6027:Gnptab	UTSW	10	88433225	missense	probably damaging	0.98
R6074:Gnptab	UTSW	10	88433078	missense	probably damaging	1.00
R6119:Gnptab	UTSW	10	88431395	missense	probably damaging	1.00
R6182:Gnptab	UTSW	10	88429480	missense	possibly damaging	0.71
R6757:Gnptab	UTSW	10	88437502	missense	probably damaging	0.98
R6910:Gnptab	UTSW	10	88431396	missense	probably damaging	1.00
R6911:Gnptab	UTSW	10	88431396	missense	probably damaging	1.00
R7094:Gnptab	UTSW	10	88379504	missense	possibly damaging	0.66
R7101:Gnptab	UTSW	10	88440312	missense	probably benign	0.19
R7164:Gnptab	UTSW	10	88434070	nonsense	probably null
R7214:Gnptab	UTSW	10	88379157	unclassified	probably benign
R7316:Gnptab	UTSW	10	88400710	missense	probably damaging	1.00
R7463:Gnptab	UTSW	10	88431389	missense	probably damaging	1.00
R7596:Gnptab	UTSW	10	88443370	missense	probably damaging	0.99
R7654:Gnptab	UTSW	10	88445819	missense	possibly damaging	0.63
R7722:Gnptab	UTSW	10	88379528	missense	probably damaging	0.99
R7770:Gnptab	UTSW	10	88411920	missense	probably benign	0.41
R7791:Gnptab	UTSW	10	88440222	critical splice acceptor site	probably null
R7838:Gnptab	UTSW	10	88440392	critical splice donor site	probably null
R8002:Gnptab	UTSW	10	88440268	missense	probably benign	0.14
R8168:Gnptab	UTSW	10	88419133	missense	probably benign	0.41
R8221:Gnptab	UTSW	10	88440392	critical splice donor site	probably null
R8313:Gnptab	UTSW	10	88439209	missense	probably damaging	1.00
R8351:Gnptab	UTSW	10	88414486	missense	probably benign	0.01
R8487:Gnptab	UTSW	10	88432646	critical splice donor site	probably null
R9108:Gnptab	UTSW	10	88433538	missense
R9352:Gnptab	UTSW	10	88432488	missense	probably benign	0.05
R9489:Gnptab	UTSW	10	88433130	missense	probably damaging	1.00
R9598:Gnptab	UTSW	10	88412014	missense	probably damaging	0.97
R9760:Gnptab	UTSW	10	88431448	missense	probably damaging	1.00
R9771:Gnptab	UTSW	10	88432623	missense	probably damaging	1.00
X0064:Gnptab	UTSW	10	88436530	missense	probably damaging	1.00
X0066:Gnptab	UTSW	10	88412011	missense	probably damaging	0.99
Z1176:Gnptab	UTSW	10	88431368	missense	probably damaging	1.00
Z1177:Gnptab	UTSW	10	88440270	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CGTGGAGACATCACTCTGAAAGG -3'
(R):5'- GTACAGCATTGCCTTCTGCC -3'

Sequencing Primer
(F):5'- CACTCTGAAAGGATATAACTTGTCC -3'
(R):5'- ATTGCCTTCTGCCCTGTCAC -3'

Posted On

2020-07-13