Incidental Mutation 'R1403:Arhgap29'
ID188597
Institutional Source Beutler Lab
Gene Symbol Arhgap29
Ensembl Gene ENSMUSG00000039831
Gene NameRho GTPase activating protein 29
SynonymsB130017I01Rik, 6720461J18Rik, C76601, Parg1
MMRRC Submission 039465-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1403 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location121952541-122016753 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 121973929 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 7 (K7E)
Ref Sequence ENSEMBL: ENSMUSP00000044624 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037958] [ENSMUST00000196479] [ENSMUST00000196904] [ENSMUST00000196984] [ENSMUST00000197155]
Predicted Effect probably damaging
Transcript: ENSMUST00000037958
AA Change: K7E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000044624
Gene: ENSMUSG00000039831
AA Change: K7E

DomainStartEndE-ValueType
low complexity region 5 12 N/A INTRINSIC
PDB:3QWE|A 193 469 5e-41 PDB
Blast:RhoGAP 412 595 9e-84 BLAST
C1 613 659 2.48e-6 SMART
RhoGAP 684 885 1.92e-68 SMART
low complexity region 947 961 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000196479
SMART Domains Protein: ENSMUSP00000142817
Gene: ENSMUSG00000039831

DomainStartEndE-ValueType
PDB:3QWE|A 129 271 1e-28 PDB
Blast:FCH 133 220 1e-10 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000196904
Predicted Effect silent
Transcript: ENSMUST00000196984
Predicted Effect probably damaging
Transcript: ENSMUST00000197155
AA Change: K7E

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000142945
Gene: ENSMUSG00000039831
AA Change: K7E

DomainStartEndE-ValueType
low complexity region 5 12 N/A INTRINSIC
PDB:3QWE|A 193 469 8e-42 PDB
Blast:RhoGAP 412 595 2e-87 BLAST
C1 613 659 2.48e-6 SMART
RhoGAP 684 780 1.14e-6 SMART
Meta Mutation Damage Score 0.0623 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 94% (51/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Rap1 is a small GTPase that, through effectors, regulates Rho GTPase signaling. These effectors- Rasip1, Radil, and the protein encoded by this gene- translocate to the cell membrane, where they form a multiprotein complex. This complex is necessary for Rap1-induced inhibition of Rho signaling. Defects in this gene may be a cause of nonsyndromic cleft lip with or without cleft palate. [provided by RefSeq, Jun 2016]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 G A 4: 53,059,253 probably benign Het
AC238840.3 T G 7: 38,867,921 I28L probably benign Het
Acsf2 G T 11: 94,562,874 N420K probably benign Het
Adam26a A T 8: 43,569,192 C420* probably null Het
Afap1l1 T C 18: 61,741,838 Y424C probably damaging Het
Agl A G 3: 116,782,597 V553A probably benign Het
Akr7a5 T A 4: 139,318,123 M325K probably damaging Het
Akt3 C T 1: 177,131,110 probably benign Het
Aldh7a1 C A 18: 56,559,269 E87* probably null Het
Brca2 T A 5: 150,542,649 D1959E probably benign Het
Cdc42se2 A G 11: 54,720,366 probably benign Het
Cdh7 G A 1: 110,061,132 V255I probably benign Het
Chil5 G T 3: 106,018,093 Q171K probably benign Het
Cul9 C G 17: 46,522,175 A1326P probably damaging Het
Dhrs7c A T 11: 67,811,650 I155F probably damaging Het
Dip2c A G 13: 9,553,264 probably null Het
Ell T A 8: 70,591,488 probably benign Het
Fam124b T C 1: 80,213,339 Y109C possibly damaging Het
Gak T A 5: 108,591,145 K156M probably damaging Het
Gm9797 C A 10: 11,609,550 noncoding transcript Het
Got1l1 C G 8: 27,200,717 probably null Het
Grm1 T C 10: 11,080,135 D135G probably benign Het
Hrh3 T G 2: 180,102,754 D131A probably damaging Het
Itpr1 A T 6: 108,389,553 Q979L probably null Het
Kdm7a C A 6: 39,151,253 probably benign Het
Klb G C 5: 65,348,746 R112P possibly damaging Het
Lingo2 A T 4: 35,709,420 C187S possibly damaging Het
Lrp1 T A 10: 127,581,891 probably null Het
Ltbp4 T C 7: 27,329,039 N266S unknown Het
Mgam G A 6: 40,666,881 S581N possibly damaging Het
Mrgpra9 T A 7: 47,235,638 I94L probably benign Het
Msantd4 A T 9: 4,384,023 I115F probably benign Het
Mterf3 A G 13: 66,929,880 probably benign Het
Neurl1a C A 19: 47,253,711 N414K probably damaging Het
Nfkbiz A G 16: 55,816,470 probably benign Het
Nrxn1 A C 17: 90,643,053 L566R probably benign Het
Nsmce1 A G 7: 125,467,855 probably benign Het
Olfr483 T A 7: 108,103,615 I102N probably benign Het
Prl7d1 A T 13: 27,709,197 F243I possibly damaging Het
Rbm27 T C 18: 42,317,681 S509P probably damaging Het
Rnf126 C T 10: 79,760,868 A239T probably benign Het
Rnf44 C T 13: 54,682,008 E306K probably damaging Het
Rp1 T C 1: 4,346,297 R1531G possibly damaging Het
Sf3b4 A G 3: 96,173,637 probably null Het
Stk4 C T 2: 164,100,528 T360M probably benign Het
Syt15 C A 14: 34,221,202 probably benign Het
Vcan T A 13: 89,688,484 E2980D probably benign Het
Vps13b A G 15: 35,709,122 probably benign Het
Vwa2 C T 19: 56,881,138 P2S unknown Het
Wdr77 G A 3: 105,967,257 V322I possibly damaging Het
Zfp12 C A 5: 143,244,780 Y287* probably null Het
Zfp937 T A 2: 150,238,948 Y299* probably null Het
Other mutations in Arhgap29
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00492:Arhgap29 APN 3 122003312 nonsense probably null
IGL01121:Arhgap29 APN 3 122009863 missense probably damaging 1.00
IGL01622:Arhgap29 APN 3 121974124 splice site probably benign
IGL01623:Arhgap29 APN 3 121974124 splice site probably benign
IGL01995:Arhgap29 APN 3 122014328 missense probably benign 0.00
IGL02120:Arhgap29 APN 3 122004257 missense probably benign 0.05
IGL02554:Arhgap29 APN 3 121992524 unclassified probably benign
IGL02931:Arhgap29 APN 3 121992860 missense probably benign
IGL02937:Arhgap29 APN 3 121974049 missense probably damaging 0.99
PIT4362001:Arhgap29 UTSW 3 122003212 missense probably benign 0.42
R0022:Arhgap29 UTSW 3 121988937 missense possibly damaging 0.61
R0574:Arhgap29 UTSW 3 122007625 missense probably benign 0.01
R0601:Arhgap29 UTSW 3 121991110 missense probably damaging 1.00
R0639:Arhgap29 UTSW 3 122007641 missense probably damaging 1.00
R0881:Arhgap29 UTSW 3 122014679 missense probably damaging 1.00
R1232:Arhgap29 UTSW 3 122003340 missense probably damaging 1.00
R1295:Arhgap29 UTSW 3 121992395 missense probably benign 0.27
R1296:Arhgap29 UTSW 3 121992395 missense probably benign 0.27
R1403:Arhgap29 UTSW 3 121973929 missense probably damaging 1.00
R1470:Arhgap29 UTSW 3 121992319 unclassified probably benign
R1710:Arhgap29 UTSW 3 122008080 missense probably damaging 1.00
R1878:Arhgap29 UTSW 3 122011371 missense probably damaging 1.00
R2051:Arhgap29 UTSW 3 121981860 missense probably benign 0.01
R2112:Arhgap29 UTSW 3 122011561 missense probably benign 0.03
R2188:Arhgap29 UTSW 3 121991009 missense probably damaging 1.00
R2240:Arhgap29 UTSW 3 122011453 missense probably benign 0.12
R2420:Arhgap29 UTSW 3 121973980 missense probably benign
R3618:Arhgap29 UTSW 3 121988527 missense possibly damaging 0.62
R4673:Arhgap29 UTSW 3 122014971 missense probably damaging 1.00
R4717:Arhgap29 UTSW 3 122009958 missense possibly damaging 0.82
R5028:Arhgap29 UTSW 3 122010060 critical splice donor site probably null
R5043:Arhgap29 UTSW 3 121974004 missense probably benign 0.00
R5045:Arhgap29 UTSW 3 122002595 missense probably benign 0.28
R5463:Arhgap29 UTSW 3 121988551 missense possibly damaging 0.94
R5495:Arhgap29 UTSW 3 122014929 missense probably damaging 1.00
R5743:Arhgap29 UTSW 3 121981911 missense probably damaging 1.00
R5791:Arhgap29 UTSW 3 122014245 missense probably damaging 0.98
R5896:Arhgap29 UTSW 3 122012087 missense possibly damaging 0.78
R6083:Arhgap29 UTSW 3 121992748 missense probably benign 0.00
R6355:Arhgap29 UTSW 3 122011258 missense possibly damaging 0.46
R6451:Arhgap29 UTSW 3 121993581 missense probably damaging 1.00
R6528:Arhgap29 UTSW 3 122014702 missense probably benign 0.13
R7239:Arhgap29 UTSW 3 121988950 missense probably benign 0.16
R7669:Arhgap29 UTSW 3 121992812 missense probably damaging 1.00
R7807:Arhgap29 UTSW 3 122014332 missense probably benign 0.01
R8045:Arhgap29 UTSW 3 122007562 synonymous silent
R8048:Arhgap29 UTSW 3 121992901 missense probably damaging 1.00
R8165:Arhgap29 UTSW 3 121988573 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GGAAAGCTCAGGCTCTTTGCATTG -3'
(R):5'- TGCTCTTGTCATGGGACACACATTG -3'

Sequencing Primer
(F):5'- ATCATGGAGTTGTCAGACACTCG -3'
(R):5'- GTTGACAAACCTGAAAGAATAGCTTC -3'
Posted On2014-05-09