Incidental Mutation 'R7796:Kidins220'
ID600240
Institutional Source Beutler Lab
Gene Symbol Kidins220
Ensembl Gene ENSMUSG00000036333
Gene Namekinase D-interacting substrate 220
SynonymsC330002I19Rik, 3110039L19Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7796 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location24974925-25063152 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 24982351 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 28 (C28R)
Ref Sequence ENSEMBL: ENSMUSP00000063999 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066652] [ENSMUST00000220459] [ENSMUST00000222941]
Predicted Effect probably damaging
Transcript: ENSMUST00000066652
AA Change: C28R

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000063999
Gene: ENSMUSG00000036333
AA Change: C28R

DomainStartEndE-ValueType
ANK 37 66 1.11e-7 SMART
ANK 70 99 2.25e-3 SMART
ANK 103 132 4.78e-7 SMART
ANK 136 165 5.53e-3 SMART
ANK 169 198 2.52e-6 SMART
ANK 202 231 6.26e-2 SMART
ANK 235 264 1.22e-4 SMART
ANK 268 297 6.92e-4 SMART
ANK 301 330 1.57e-2 SMART
ANK 334 363 9.78e-4 SMART
ANK 367 398 4.6e0 SMART
Pfam:KAP_NTPase 440 953 1.2e-112 PFAM
low complexity region 1077 1092 N/A INTRINSIC
low complexity region 1096 1107 N/A INTRINSIC
low complexity region 1382 1396 N/A INTRINSIC
low complexity region 1422 1452 N/A INTRINSIC
low complexity region 1509 1520 N/A INTRINSIC
low complexity region 1544 1555 N/A INTRINSIC
low complexity region 1561 1567 N/A INTRINSIC
low complexity region 1596 1609 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000220459
Predicted Effect possibly damaging
Transcript: ENSMUST00000222941
AA Change: C28R

PolyPhen 2 Score 0.783 (Sensitivity: 0.85; Specificity: 0.93)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane protein that is preferentially expressed in the nervous system where it controls neuronal cell survival, differentiation into exons and dendrites, and synaptic plasticity. The encoded protein interacts with membrane receptors, cytosolic signaling components, and cytoskeletal proteins, serving as a scaffold that mediates crosstalk between the neurotrophin pathway and several other intracellular signaling pathways. Aberrant expression of this gene is associated with the onset of various neuropsychiatric disorders and neurodegenerative diseases, including Alzheimer's disease. Naturally occurring mutations in this gene are associated with a syndrome characterized by spastic paraplegia, intellectual disability, nystagmus and obesity. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2017]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality. Mice heterozygous for a knock-out allele exhibit decreased dendritic complexity in the barrel somatosensory cortex and dentate gyrus neurons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630089N07Rik T A 16: 98,065,824 I313F probably benign Het
Acot2 T A 12: 83,988,483 probably null Het
Agbl4 G T 4: 110,660,968 G152V unknown Het
Arap2 A G 5: 62,730,762 S414P probably damaging Het
C330021F23Rik T C 8: 3,584,160 V111A probably benign Het
Cep85l A C 10: 53,281,401 N735K probably damaging Het
Col12a1 T C 9: 79,678,551 S1209G possibly damaging Het
Dennd1b G A 1: 139,062,873 E192K probably damaging Het
Dpf1 C G 7: 29,311,681 N168K possibly damaging Het
Dync1li2 T A 8: 104,430,549 Y184F probably damaging Het
Epb41l2 A G 10: 25,443,829 T187A probably benign Het
Fam50b G A 13: 34,747,101 E187K possibly damaging Het
Fndc3b G A 3: 27,461,743 T638I probably benign Het
Gm11564 A G 11: 99,815,598 V2A unknown Het
Gm13088 T A 4: 143,654,157 D432V possibly damaging Het
Gm3159 A G 14: 4,400,560 *206W probably null Het
Gm32742 A G 9: 51,159,823 probably null Het
Gm4847 G A 1: 166,642,250 H85Y probably damaging Het
Gprc5c A T 11: 114,864,532 D345V probably damaging Het
Kalrn A T 16: 34,187,484 Y1363* probably null Het
Kdm5a T C 6: 120,390,763 V473A probably damaging Het
Klhl5 T C 5: 65,164,622 Y664H probably damaging Het
Krt17 A G 11: 100,260,872 S32P probably benign Het
Krt83 A G 15: 101,485,984 V424A possibly damaging Het
Lipo1 T C 19: 33,782,234 T201A possibly damaging Het
Megf10 C A 18: 57,277,659 T680N possibly damaging Het
Metap1d T A 2: 71,512,162 D178E probably damaging Het
Miip C T 4: 147,862,918 G236S probably benign Het
Mki67 A G 7: 135,698,194 S1704P probably damaging Het
Nr2f2 A G 7: 70,358,153 S194P probably benign Het
Nrsn2 T A 2: 152,376,551 probably benign Het
Ociad1 C T 5: 73,294,947 P27L probably damaging Het
Olfr1238 T A 2: 89,406,813 T89S possibly damaging Het
Olfr1339 T A 4: 118,734,685 I52N probably damaging Het
Patj A T 4: 98,546,983 M1L probably benign Het
Pcdhb2 A G 18: 37,295,393 I140V possibly damaging Het
Pla2g6 T C 15: 79,317,825 N49D probably benign Het
Pxdc1 T A 13: 34,652,371 N22I probably damaging Het
Rpgrip1l A G 8: 91,270,237 Y672H probably damaging Het
Safb2 T C 17: 56,566,327 R779G possibly damaging Het
Skiv2l C T 17: 34,844,418 G628S probably damaging Het
Smg5 A T 3: 88,349,432 Q299L probably damaging Het
Sptbn2 C G 19: 4,749,012 R2037G probably benign Het
Sulf1 T C 1: 12,858,820 L864S probably benign Het
Tas1r1 A G 4: 152,034,755 V119A probably benign Het
Tasp1 T C 2: 140,008,785 N106S probably damaging Het
Tcf4 T A 18: 69,564,069 N156K probably benign Het
Trav14n-3 T A 14: 53,370,370 Y52* probably null Het
Ttn T C 2: 76,834,878 E11598G unknown Het
Unc80 A G 1: 66,503,714 I376V probably benign Het
Ybx3 T C 6: 131,368,516 E298G probably damaging Het
Yipf7 T C 5: 69,527,253 Y73C possibly damaging Het
Zdbf2 G A 1: 63,303,424 A321T possibly damaging Het
Zfp369 A G 13: 65,296,215 R391G probably benign Het
Zfp54 A G 17: 21,434,720 E492G probably damaging Het
Zfp971 A G 2: 178,031,610 T51A probably benign Het
Other mutations in Kidins220
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00551:Kidins220 APN 12 25038560 splice site probably benign
IGL00959:Kidins220 APN 12 25051133 missense possibly damaging 0.74
IGL00978:Kidins220 APN 12 25057474 missense probably damaging 1.00
IGL01144:Kidins220 APN 12 25010926 missense probably damaging 1.00
IGL01326:Kidins220 APN 12 25038499 missense probably damaging 0.97
IGL01545:Kidins220 APN 12 25040460 missense possibly damaging 0.66
IGL01802:Kidins220 APN 12 24995000 missense probably damaging 1.00
IGL01875:Kidins220 APN 12 25057729 missense probably benign 0.00
IGL02160:Kidins220 APN 12 25004111 missense probably damaging 1.00
IGL02383:Kidins220 APN 12 24997333 splice site probably benign
IGL02673:Kidins220 APN 12 24994992 missense probably damaging 1.00
IGL02800:Kidins220 APN 12 25003093 missense probably damaging 1.00
IGL03345:Kidins220 APN 12 25003045 missense probably damaging 1.00
IGL03379:Kidins220 APN 12 25008448 missense probably damaging 0.99
IGL03412:Kidins220 APN 12 24999345 missense probably damaging 1.00
P0043:Kidins220 UTSW 12 25008156 missense probably damaging 1.00
R0011:Kidins220 UTSW 12 24999352 missense probably damaging 0.99
R0011:Kidins220 UTSW 12 24999352 missense probably damaging 0.99
R0269:Kidins220 UTSW 12 25040512 missense probably damaging 0.98
R0280:Kidins220 UTSW 12 25010141 missense probably damaging 1.00
R0334:Kidins220 UTSW 12 25008069 missense probably damaging 1.00
R1601:Kidins220 UTSW 12 25005088 missense probably benign 0.35
R1778:Kidins220 UTSW 12 25013446 splice site probably benign
R1808:Kidins220 UTSW 12 25003009 missense probably benign 0.00
R1855:Kidins220 UTSW 12 25056591 missense probably damaging 1.00
R1965:Kidins220 UTSW 12 24994906 missense probably damaging 1.00
R1982:Kidins220 UTSW 12 25051194 missense probably benign 0.01
R2069:Kidins220 UTSW 12 24987006 splice site probably benign
R2101:Kidins220 UTSW 12 25057423 missense probably damaging 1.00
R2124:Kidins220 UTSW 12 25041303 critical splice donor site probably null
R2371:Kidins220 UTSW 12 25057324 missense probably damaging 1.00
R2405:Kidins220 UTSW 12 25011509 missense probably damaging 0.99
R3522:Kidins220 UTSW 12 24990758 missense probably damaging 1.00
R3877:Kidins220 UTSW 12 25001565 splice site probably benign
R3915:Kidins220 UTSW 12 25053958 missense possibly damaging 0.93
R4023:Kidins220 UTSW 12 25057144 intron probably null
R4287:Kidins220 UTSW 12 25056846 missense possibly damaging 0.81
R4476:Kidins220 UTSW 12 25011001 missense probably damaging 1.00
R4495:Kidins220 UTSW 12 25038302 intron probably null
R4627:Kidins220 UTSW 12 25057042 missense possibly damaging 0.89
R4807:Kidins220 UTSW 12 25057285 missense probably damaging 1.00
R4899:Kidins220 UTSW 12 25013443 critical splice donor site probably null
R4960:Kidins220 UTSW 12 24992260 nonsense probably null
R5118:Kidins220 UTSW 12 24992297 missense probably damaging 1.00
R5183:Kidins220 UTSW 12 25051126 missense probably benign 0.17
R5238:Kidins220 UTSW 12 25003010 missense probably benign 0.31
R5580:Kidins220 UTSW 12 25047897 missense probably benign 0.00
R5707:Kidins220 UTSW 12 25013391 missense probably damaging 1.00
R5813:Kidins220 UTSW 12 25057140 nonsense probably null
R6131:Kidins220 UTSW 12 24992314 splice site probably null
R6146:Kidins220 UTSW 12 25052813 missense probably damaging 1.00
R6151:Kidins220 UTSW 12 25056909 missense possibly damaging 0.65
R6160:Kidins220 UTSW 12 24997311 missense probably damaging 1.00
R6187:Kidins220 UTSW 12 25051308 intron probably null
R6289:Kidins220 UTSW 12 25056616 missense probably damaging 1.00
R6321:Kidins220 UTSW 12 25057534 missense probably benign 0.09
R6450:Kidins220 UTSW 12 25057191 missense probably benign
R6513:Kidins220 UTSW 12 25038435 missense possibly damaging 0.94
R6652:Kidins220 UTSW 12 25010060 splice site probably null
R6711:Kidins220 UTSW 12 24998751 missense probably damaging 0.96
R6858:Kidins220 UTSW 12 25008543 missense possibly damaging 0.85
R7102:Kidins220 UTSW 12 25057663 missense probably benign 0.00
R7112:Kidins220 UTSW 12 25004019 missense probably damaging 1.00
R7139:Kidins220 UTSW 12 24994821 missense probably damaging 1.00
R7140:Kidins220 UTSW 12 25036624 missense probably damaging 1.00
R7271:Kidins220 UTSW 12 25011571 missense probably benign 0.21
R7361:Kidins220 UTSW 12 25057000 missense probably benign 0.01
R7509:Kidins220 UTSW 12 24982361 missense probably damaging 0.98
R7510:Kidins220 UTSW 12 24992269 missense possibly damaging 0.88
R7783:Kidins220 UTSW 12 24988556 missense probably damaging 1.00
R7831:Kidins220 UTSW 12 25061231 missense possibly damaging 0.90
R7914:Kidins220 UTSW 12 25061231 missense possibly damaging 0.90
R8074:Kidins220 UTSW 12 25057716 missense probably benign 0.29
Predicted Primers PCR Primer
(F):5'- GGAGGTGTGTCTGAACATATGTAAG -3'
(R):5'- GCTTTCAAAACACAGAGTGGAATAC -3'

Sequencing Primer
(F):5'- TGTCTGAACATATGTAAGGGTAAAAC -3'
(R):5'- CACTGCAACATGGGAAAC -3'
Posted On2019-11-26