Mutagenetix > Incidental Mutations

Incidental Mutation 'R0051:Med13l'

64283

Institutional Source

Beutler Lab

Gene Symbol

Med13l

Ensembl Gene

ENSMUSG00000018076

Gene Name

mediator complex subunit 13-like

Synonyms

9030618F05Rik, Thrap2, 6330591G05Rik, 2210413I17Rik, Trap240L

MMRRC Submission

038345-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.960) question?

Stock #

R0051 (G1)

Quality Score

151

Status

Validated

Chromosome

Chromosomal Location

118560679-118765438 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 118742655 bp

Zygosity

Heterozygous

Amino Acid Change

Tryptophan to Arginine at position 1271 (W1271R)

Ref Sequence

ENSEMBL: ENSMUSP00000098379 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000100816] [ENSMUST00000201010]

Predicted Effect

probably damaging
Transcript: ENSMUST00000100816
AA Change: W1271R

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000098379
Gene: ENSMUSG00000018076
AA Change: W1271R

Domain	Start	End	E-Value	Type
Pfam:Med13_N	1	380	2.5e-116	PFAM
low complexity region	442	460	N/A	INTRINSIC
low complexity region	542	558	N/A	INTRINSIC
low complexity region	1020	1031	N/A	INTRINSIC
low complexity region	1044	1060	N/A	INTRINSIC
low complexity region	1541	1593	N/A	INTRINSIC
low complexity region	1601	1611	N/A	INTRINSIC
Pfam:Med13_C	1675	2197	1e-142	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000201010
AA Change: W1271R

PolyPhen 2 Score 0.089 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000144092
Gene: ENSMUSG00000018076
AA Change: W1271R

Domain	Start	End	E-Value	Type
Pfam:Med13_N	1	380	1e-112	PFAM
low complexity region	442	460	N/A	INTRINSIC
low complexity region	542	558	N/A	INTRINSIC
low complexity region	1020	1031	N/A	INTRINSIC
low complexity region	1044	1060	N/A	INTRINSIC
low complexity region	1541	1593	N/A	INTRINSIC
low complexity region	1601	1611	N/A	INTRINSIC
Pfam:Med13_C	1675	2206	1.7e-138	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000202538

Meta Mutation Damage Score

0.2932

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.1%
20x: 93.8%

Validation Efficiency

100% (64/64)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a subunit of the Mediator complex, a large complex of proteins that functions as a transcriptional coactivator for most RNA polymerase II-transcribed genes. The encoded protein is involved in early development of the heart and brain. Defects in this gene are a cause of transposition of the great arteries, dextro-looped (DTGA).[provided by RefSeq, Jul 2010]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930432E11Rik	A	G	7: 29,579,101		noncoding transcript	Het
Abr	T	A	11: 76,472,502	Q163L	probably benign	Het
AI314180	A	G	4: 58,832,729	L877S	probably damaging	Het
Ankrd11	C	A	8: 122,889,742	C2457F	probably damaging	Het
Anks3	G	C	16: 4,947,749	T163S	probably benign	Het
Cacna1d	G	A	14: 30,111,095	P908S	probably damaging	Het
Ccdc146	C	A	5: 21,316,904	R374L	possibly damaging	Het
Cdc45	G	T	16: 18,794,774	A348E	probably damaging	Het
Cfap46	A	G	7: 139,676,035	C300R	probably damaging	Het
Coq2	T	C	5: 100,663,685	N146S	probably benign	Het
Dalrd3	T	C	9: 108,572,215	V120A	possibly damaging	Het
Dcp2	T	A	18: 44,405,374		probably benign	Het
Ddx39	A	G	8: 83,720,622	K137R	possibly damaging	Het
Diaph3	A	G	14: 87,037,454		probably null	Het
Dmbt1	G	T	7: 131,119,496	R1668L	possibly damaging	Het
Dnah7a	T	G	1: 53,521,086		probably benign	Het
Dpp7	A	G	2: 25,356,095	Y49H	possibly damaging	Het
Drd5	A	G	5: 38,320,614	S317G	probably benign	Het
Ecsit	C	T	9: 22,076,288	V152I	probably benign	Het
Emc1	T	A	4: 139,375,163	M923K	possibly damaging	Het
Fam102a	G	A	2: 32,558,053	R58Q	possibly damaging	Het
Fcrl6	A	T	1: 172,598,753	L159Q	probably benign	Het
Frrs1	T	C	3: 116,885,297		probably benign	Het
Hspd1	A	G	1: 55,082,046		probably benign	Het
Impg2	T	A	16: 56,258,048	S458T	probably damaging	Het
Klf17	T	C	4: 117,760,392	Y256C	probably damaging	Het
Lnx2	A	G	5: 147,029,353	F319L	probably damaging	Het
Mafg	G	T	11: 120,629,604	R57S	probably damaging	Het
Mrgprb1	A	G	7: 48,447,214	S24P	probably benign	Het
Mtrf1l	T	C	10: 5,813,384	E315G	probably damaging	Het
Naip1	T	C	13: 100,411,001	E1239G	probably damaging	Het
Ncaph2	T	C	15: 89,369,664	S320P	probably damaging	Het
Nek11	A	G	9: 105,218,539		probably benign	Het
Nlrp2	A	T	7: 5,322,334		probably benign	Het
Odf3	C	A	7: 140,850,221		probably benign	Het
Rbm26	A	C	14: 105,152,540	V216G	possibly damaging	Het
Rnf115	A	G	3: 96,785,022	D178G	probably damaging	Het
Rtel1	C	T	2: 181,350,656	Q424*	probably null	Het
Rwdd4a	A	G	8: 47,537,365		probably benign	Het
Ryr3	T	C	2: 112,869,075	D890G	probably damaging	Het
Scarb1	C	A	5: 125,281,100		probably null	Het
Serpina10	A	G	12: 103,626,897		probably benign	Het
Slc12a5	T	A	2: 164,986,663	W508R	probably damaging	Het
Slc43a2	T	C	11: 75,562,850	C225R	probably damaging	Het
Slc6a9	T	C	4: 117,864,859	F440L	probably damaging	Het
Stac3	G	A	10: 127,508,148	R305H	probably damaging	Het
Stk32b	A	G	5: 37,459,596		probably benign	Het
Syna	A	T	5: 134,559,543	L184H	probably damaging	Het
Tmprss7	T	C	16: 45,673,939	N401S	probably damaging	Het
Yeats2	T	A	16: 20,193,724	Y557*	probably null	Het
Zcchc11	T	G	4: 108,527,004	S1089R	probably damaging	Het
Zfp352	T	C	4: 90,224,285	S221P	probably damaging	Het
Zfp575	A	G	7: 24,586,087	V43A	probably benign	Het
Zfp775	A	G	6: 48,620,772	T527A	probably benign	Het

Other mutations in Med13l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00232:Med13l	APN	5	118724071	missense	probably damaging	0.99
IGL01012:Med13l	APN	5	118734028	missense	probably damaging	0.99
IGL01316:Med13l	APN	5	118762781	missense	probably damaging	1.00
IGL01529:Med13l	APN	5	118742335	missense	probably damaging	1.00
IGL01731:Med13l	APN	5	118742407	missense	probably benign	0.05
IGL01790:Med13l	APN	5	118593522	missense	probably damaging	1.00
IGL02394:Med13l	APN	5	118748833	missense	probably benign	0.37
IGL02432:Med13l	APN	5	118738400	missense	possibly damaging	0.90
IGL02698:Med13l	APN	5	118762829	missense	probably damaging	0.99
IGL02801:Med13l	APN	5	118745113	missense	probably damaging	1.00
IGL03242:Med13l	APN	5	118747445	missense	probably benign
IGL03270:Med13l	APN	5	118731430	missense	probably damaging	1.00
Basics	UTSW	5	118759264	critical splice donor site	probably null
Fundament	UTSW	5	118721474	missense	probably damaging	1.00
Root	UTSW	5	118593445	missense	probably damaging	1.00
P0035:Med13l	UTSW	5	118742620	missense	probably benign	0.00
R0051:Med13l	UTSW	5	118742655	missense	probably damaging	1.00
R0136:Med13l	UTSW	5	118724050	missense	probably benign	0.15
R0158:Med13l	UTSW	5	118742449	missense	unknown
R0197:Med13l	UTSW	5	118671002	splice site	probably benign
R0370:Med13l	UTSW	5	118741826	missense	probably benign	0.14
R0492:Med13l	UTSW	5	118738495	missense	probably damaging	1.00
R0532:Med13l	UTSW	5	118759123	missense	possibly damaging	0.78
R0726:Med13l	UTSW	5	118748684	missense	probably damaging	0.99
R0738:Med13l	UTSW	5	118751633	missense	probably damaging	0.99
R0827:Med13l	UTSW	5	118726247	splice site	probably benign
R0883:Med13l	UTSW	5	118671002	splice site	probably benign
R0959:Med13l	UTSW	5	118754285	missense	possibly damaging	0.89
R1458:Med13l	UTSW	5	118738459	missense	probably benign	0.00
R1562:Med13l	UTSW	5	118738519	missense	probably damaging	1.00
R1577:Med13l	UTSW	5	118721392	missense	probably damaging	1.00
R1661:Med13l	UTSW	5	118749748	missense	probably damaging	1.00
R1665:Med13l	UTSW	5	118749748	missense	probably damaging	1.00
R1720:Med13l	UTSW	5	118741995	missense	probably damaging	1.00
R1929:Med13l	UTSW	5	118728833	missense	probably benign	0.01
R1967:Med13l	UTSW	5	118761322	missense	probably damaging	0.99
R2301:Med13l	UTSW	5	118593447	missense	probably damaging	1.00
R3691:Med13l	UTSW	5	118721497	missense	probably benign	0.16
R3895:Med13l	UTSW	5	118761323	missense	probably null	0.99
R4043:Med13l	UTSW	5	118593463	missense	probably damaging	1.00
R4593:Med13l	UTSW	5	118742560	missense	probably damaging	1.00
R4902:Med13l	UTSW	5	118745130	missense	probably damaging	1.00
R4995:Med13l	UTSW	5	118730949	missense	possibly damaging	0.90
R5010:Med13l	UTSW	5	118593550	missense	possibly damaging	0.95
R5057:Med13l	UTSW	5	118718493	missense	probably damaging	1.00
R5369:Med13l	UTSW	5	118724010	missense	probably benign	0.02
R5446:Med13l	UTSW	5	118742397	missense	possibly damaging	0.81
R5564:Med13l	UTSW	5	118742040	missense	probably damaging	1.00
R5566:Med13l	UTSW	5	118728665	missense	possibly damaging	0.95
R5580:Med13l	UTSW	5	118751630	missense	possibly damaging	0.95
R5634:Med13l	UTSW	5	118560850	missense	possibly damaging	0.88
R5748:Med13l	UTSW	5	118593445	missense	probably damaging	1.00
R5764:Med13l	UTSW	5	118728642	missense	probably damaging	0.99
R5765:Med13l	UTSW	5	118728642	missense	probably damaging	0.99
R6083:Med13l	UTSW	5	118721486	missense	possibly damaging	0.80
R6504:Med13l	UTSW	5	118754321	missense	probably benign	0.34
R6546:Med13l	UTSW	5	118721474	missense	probably damaging	1.00
R6797:Med13l	UTSW	5	118759264	critical splice donor site	probably null
R6911:Med13l	UTSW	5	118755658	missense	possibly damaging	0.95
R6942:Med13l	UTSW	5	118745006	splice site	probably null
R7018:Med13l	UTSW	5	118751986	missense	probably damaging	0.99
R7096:Med13l	UTSW	5	118721926	missense	possibly damaging	0.90
R7113:Med13l	UTSW	5	118726265	missense	probably benign	0.09
R7136:Med13l	UTSW	5	118721522	missense	possibly damaging	0.90
R7140:Med13l	UTSW	5	118741972	missense	probably benign	0.27
R7345:Med13l	UTSW	5	118742760	missense	probably damaging	1.00
R7409:Med13l	UTSW	5	118754321	missense	probably benign	0.34
R7410:Med13l	UTSW	5	118560832	missense	possibly damaging	0.94
R7432:Med13l	UTSW	5	118751938	missense	probably damaging	0.99
R7486:Med13l	UTSW	5	118728474	missense	probably benign	0.17
R7509:Med13l	UTSW	5	118748930	missense	probably damaging	0.97
R7722:Med13l	UTSW	5	118747407	missense	probably benign	0.32
R7802:Med13l	UTSW	5	118728590	missense	probably benign	0.03
X0065:Med13l	UTSW	5	118729883	missense	probably damaging	1.00
Z1088:Med13l	UTSW	5	118749641	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- AGAAAGACGCCTGATGATGTGCC -3'
(R):5'- AGCACCACTTGTTTGTGATGGGATG -3'

Sequencing Primer
(F):5'- CCTGATGATGTGCCAGTCC -3'
(R):5'- GGCAGTTACTTGTCCTCAAAAGC -3'

Posted On

2013-08-06