Incidental Mutation 'R0143:Hnrnpl'
ID22439
Institutional Source Beutler Lab
Gene Symbol Hnrnpl
Ensembl Gene ENSMUSG00000015165
Gene Nameheterogeneous nuclear ribonucleoprotein L
SynonymsHnrpl, D830027H13Rik
MMRRC Submission 038428-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0143 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location28808541-28822266 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 28814192 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000133952 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038572] [ENSMUST00000172529] [ENSMUST00000172884] [ENSMUST00000174548] [ENSMUST00000174882]
Predicted Effect probably benign
Transcript: ENSMUST00000038572
SMART Domains Protein: ENSMUSP00000049407
Gene: ENSMUSG00000015165

DomainStartEndE-ValueType
low complexity region 3 57 N/A INTRINSIC
low complexity region 71 86 N/A INTRINSIC
RRM 100 169 9.8e-9 SMART
RRM 191 261 4.75e-7 SMART
low complexity region 314 339 N/A INTRINSIC
low complexity region 356 374 N/A INTRINSIC
RRM 380 449 5.09e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000172529
SMART Domains Protein: ENSMUSP00000133932
Gene: ENSMUSG00000015165

DomainStartEndE-ValueType
Blast:RRM 1 39 9e-20 BLAST
RRM 61 131 4.75e-7 SMART
low complexity region 184 209 N/A INTRINSIC
low complexity region 226 244 N/A INTRINSIC
RRM 250 319 5.09e-7 SMART
Blast:RRM_2 369 442 6e-17 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172841
Predicted Effect probably benign
Transcript: ENSMUST00000172884
SMART Domains Protein: ENSMUSP00000134271
Gene: ENSMUSG00000015165

DomainStartEndE-ValueType
Blast:RRM 1 39 1e-21 BLAST
SCOP:d1qm9a1 3 61 3e-3 SMART
Pfam:RRM_6 67 113 5.7e-5 PFAM
Pfam:RRM_1 70 113 1.3e-5 PFAM
Pfam:RRM_5 78 113 9.5e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173578
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173750
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173818
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174396
Predicted Effect probably benign
Transcript: ENSMUST00000174477
SMART Domains Protein: ENSMUSP00000134734
Gene: ENSMUSG00000015165

DomainStartEndE-ValueType
low complexity region 4 49 N/A INTRINSIC
low complexity region 63 78 N/A INTRINSIC
RRM 92 161 9.8e-9 SMART
RRM 183 253 4.75e-7 SMART
low complexity region 339 368 N/A INTRINSIC
low complexity region 385 403 N/A INTRINSIC
RRM 409 478 5.09e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174548
SMART Domains Protein: ENSMUSP00000133728
Gene: ENSMUSG00000015165

DomainStartEndE-ValueType
low complexity region 3 57 N/A INTRINSIC
low complexity region 71 86 N/A INTRINSIC
RRM 100 169 9.8e-9 SMART
RRM 191 261 4.75e-7 SMART
low complexity region 314 339 N/A INTRINSIC
low complexity region 356 374 N/A INTRINSIC
RRM 380 449 5.09e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174755
Predicted Effect probably benign
Transcript: ENSMUST00000174882
SMART Domains Protein: ENSMUSP00000133952
Gene: ENSMUSG00000015165

DomainStartEndE-ValueType
RRM 1 61 5.18e-1 SMART
RRM 83 153 4.75e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209194
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.6%
  • 20x: 93.6%
Validation Efficiency 97% (76/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Heterogeneous nuclear RNAs (hnRNAs) which include mRNA precursors and mature mRNAs are associated with specific proteins to form heterogenous ribonucleoprotein (hnRNP) complexes. Heterogeneous nuclear ribonucleoprotein L is among the proteins that are stably associated with hnRNP complexes and along with other hnRNP proteins is likely to play a major role in the formation, packaging, processing, and function of mRNA. Heterogeneous nuclear ribonucleoprotein L is present in the nucleoplasm as part of the HNRP complex. HNRP proteins have also been identified outside of the nucleoplasm. Exchange of hnRNP for mRNA-binding proteins accompanies transport of mRNA from the nucleus to the cytoplasm. Since HNRP proteins have been shown to shuttle between the nucleus and the cytoplasm, it is possible that they also have cytoplasmic functions. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted allele exhibit embryonic letahlity after E3.5. Mice homozygous for a conditional allele activated in thymocytes exhibit decreased T cells in the periphery associated with impaired thymocyte chemotaxis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim3 A T 18: 61,855,217 I145N probably benign Het
Ankrd1 G A 19: 36,119,313 A38V probably benign Het
Ankrd34b A G 13: 92,439,760 E500G probably damaging Het
Arhgef12 T C 9: 43,005,594 T419A probably damaging Het
B3galt2 A T 1: 143,647,334 N403Y possibly damaging Het
Bbx C T 16: 50,280,392 E47K probably benign Het
C4b G A 17: 34,734,219 probably benign Het
Cacna1e A T 1: 154,448,947 probably null Het
Cdh3 T C 8: 106,511,225 V17A probably benign Het
Cog7 A T 7: 121,951,164 L379Q probably damaging Het
Cul9 T C 17: 46,526,410 N1044S possibly damaging Het
Cyp4b1 C T 4: 115,635,874 D258N probably damaging Het
Ddx39 T C 8: 83,720,550 V113A probably benign Het
Dennd4b A T 3: 90,272,364 H643L probably damaging Het
Dpy19l3 T C 7: 35,714,215 T334A probably benign Het
Dsg3 T C 18: 20,536,825 L632S probably damaging Het
Dtx4 G A 19: 12,486,482 T312I probably damaging Het
Dusp18 C T 11: 3,897,243 R78C probably benign Het
Fes A C 7: 80,383,895 F203V probably benign Het
Fhad1 C A 4: 141,929,646 probably benign Het
Gjb2 T C 14: 57,100,069 silent Het
Gm5828 T C 1: 16,768,355 noncoding transcript Het
Gsdma A C 11: 98,666,254 E65A probably damaging Het
Hck T A 2: 153,134,220 probably null Het
Henmt1 A T 3: 108,953,802 H47L probably damaging Het
Hivep2 T C 10: 14,129,355 F566L probably damaging Het
Igsf3 T C 3: 101,435,601 I518T probably damaging Het
Ireb2 T C 9: 54,885,909 F223L probably benign Het
Isoc2a T C 7: 4,891,332 probably null Het
Krt73 T A 15: 101,800,773 R200W probably damaging Het
Lgals9 T A 11: 78,963,535 I308F probably damaging Het
Lrp1 A G 10: 127,593,942 F420L probably damaging Het
Mep1b T C 18: 21,095,107 probably benign Het
Mex3a G T 3: 88,536,255 A213S probably benign Het
Mmp13 T C 9: 7,276,558 F218L probably damaging Het
Ncf1 G T 5: 134,227,137 probably benign Het
Notch2 A G 3: 98,146,117 D2032G probably damaging Het
Olfr1505 A C 19: 13,919,250 I77L probably damaging Het
Olfr491 A G 7: 108,316,995 I34V probably benign Het
Olfr63 T C 17: 33,269,497 S258P probably damaging Het
Pex16 G A 2: 92,380,457 G312D probably damaging Het
Pex5 A T 6: 124,398,489 W525R probably damaging Het
Plcb4 T A 2: 135,976,211 I799N probably damaging Het
Poldip3 G A 15: 83,127,943 L372F probably damaging Het
Polg2 C A 11: 106,777,526 V174L probably benign Het
Prrt4 C G 6: 29,170,671 G594A probably damaging Het
Prss1 A G 6: 41,463,588 D199G probably damaging Het
Rbms2 T A 10: 128,137,954 Q207L probably benign Het
Retreg2 A G 1: 75,146,430 D334G possibly damaging Het
Slc6a15 T G 10: 103,418,068 C622G probably benign Het
Spdya T A 17: 71,558,640 D84E probably damaging Het
Stat3 A T 11: 100,895,156 S432T possibly damaging Het
Tiam1 A T 16: 89,898,200 V123E probably benign Het
Tnpo3 A G 6: 29,565,652 probably benign Het
Tnrc6c A C 11: 117,752,985 N1481H probably damaging Het
Top3b T C 16: 16,883,525 S234P probably damaging Het
Tor1aip2 A T 1: 156,059,548 T10S probably benign Het
Tpsab1 T A 17: 25,343,444 H303L probably benign Het
Traf3 T A 12: 111,261,576 V407D probably damaging Het
Trim33 T A 3: 103,352,101 D1035E probably benign Het
Ttc38 T C 15: 85,853,719 V402A possibly damaging Het
Ube4b C T 4: 149,355,457 R646H possibly damaging Het
Usp8 C A 2: 126,755,089 probably benign Het
Zdbf2 A T 1: 63,308,074 I1871F probably benign Het
Zfp345 T A 2: 150,472,555 Q354L probably benign Het
Zfp462 C A 4: 55,023,402 probably benign Het
Zfp81 G A 17: 33,335,121 H240Y possibly damaging Het
Zfp830 A G 11: 82,765,168 D266G possibly damaging Het
Other mutations in Hnrnpl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Hnrnpl APN 7 28813373 missense probably damaging 1.00
IGL00783:Hnrnpl APN 7 28820642 missense probably benign 0.02
IGL00784:Hnrnpl APN 7 28820642 missense probably benign 0.02
IGL03248:Hnrnpl APN 7 28814080 missense probably benign 0.00
R1529:Hnrnpl UTSW 7 28813923 missense possibly damaging 0.74
R1567:Hnrnpl UTSW 7 28820183 missense possibly damaging 0.73
R3786:Hnrnpl UTSW 7 28811011 unclassified probably benign
R4837:Hnrnpl UTSW 7 28817337 missense probably benign 0.00
R5412:Hnrnpl UTSW 7 28811104 unclassified probably benign
R6617:Hnrnpl UTSW 7 28818584 intron probably benign
R7238:Hnrnpl UTSW 7 28813975 missense
R8283:Hnrnpl UTSW 7 28814272 missense
R8336:Hnrnpl UTSW 7 28814037 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- TCTGATGACTCCCGGAGCGTAAAC -3'
(R):5'- AGCTGAGCTGTCTCACTTGCAC -3'

Sequencing Primer
(F):5'- CGGAGCGTAAACAGCGTG -3'
(R):5'- AACTCTCACAAGGGGTGC -3'
Posted On2013-04-16